Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU051621

Sigma-Aldrich

MISSION® esiRNA

targeting human GADD45A

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ATCCACTTCACCCTGATCCAGGCGTTTTGCTGCGAGAACGACATCAACATCCTGCGCGTCAGCAACCCGGGCCGGCTGGCGGAGCTCCTGCTCTTGGAGACCGACGCTGGCCCCGCGGCGAGCGAGGGCGCCGAGCAGCCCCCGGACCTGCACTGCGTGCTGGTGACGAATCCACATTCATCTCAATGGAAGGATCCTGCCTTAAGTCAACTTATTTGTTTTTGCCGGGAAAGTCGCTACATGGATCAATGGGTTCCAGTGATTAATCTCCCTGAACGGTGATGGCATCTGAATGAAAATAACTGAACCAAATTGCACTGAAGTTTTTGAAATACCTTTGTAGTTACTCAAGCAGTTACTCCCTACACTGATGCAAGGATTACAGAAACTGATGCCAAGGG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yan Tan et al.
Experimental cell research, 370(2), 718-724 (2018-07-29)
Long non-coding RNA (lncRNA) are key regulatory molecules that are implicated in diverse biological processes and human diseases, including preeclampsia. However, their expression and functions in the progression of preeclampsia remains largely unclear. In this study, lncRNA DLX6-AS1 was confirmed
Pei Ma et al.
Molecular therapy. Nucleic acids, 22, 382-395 (2020-11-25)
Long noncoding RNAs (lncRNAs), genomic "dark matter," are deeply involved in diverse biological processes. The lncRNA nuclear paraspeckle assembly transcript 1 (NEAT1) is a highly participatory lncRNA; however, its roles in gastric cancer (GC) remain largely unexplored. Here, we demonstrated
Rui-Xue Sun et al.
Gene, 763, 145030-145030 (2020-08-07)
To investigate the impact and the mechanism of Gadd45α mediating p38MAPK pathway on the retinal ganglion cells (RGCs) injury in chronic ocular hypertension (COH) rats. COH model in rats were established and intraocular pressure (IOP) was tested. Retrograde labeling was
B Wang et al.
Journal of molecular cell biology, 9(4), 338-349 (2017-10-11)
Retinoic acid (RA), a bioactive metabolite of vitamin A, is a critical mediator of cell differentiation. RA blocks adipogenesis, but mechanisms remain to be established. ZFP423 is a key transcription factor maintaining white adipose identity. We found that RA inhibits

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique