Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Documents

EHU051601

Sigma-Aldrich

MISSION® esiRNA

targeting human SMAD1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CAACAATCGTGTGGGTGAAGCGTTCCATGCCTCCTCCACAAGTGTGTTGGTGGATGGTTTCACTGATCCTTCCAACAATAAGAACCGTTTCTGCCTTGGGCTGCTCTCCAATGTTAACCGGAATTCCACTATTGAAAACACCAGGCGGCATATTGGAAAAGGAGTTCATCTTTATTATGTTGGAGGGGAGGTGTATGCCGAATGCCTTAGTGACAGTAGCATCTTTGTGCAAAGTCGGAACTGCAACTACCATCATGGATTTCATCCTACTACTGTTTGCAAGATCCCTAGTGGGTGTAGTCTGAAAATTTTTAACAACCAAGAATTTGCTCAGTTATTGGCACAGTCTGTGAACCATGGATTTGAGACAGTCTATGAGCTTACAAAAATGTGTACTATACGTATGAGCTTTGTGAAGGGCTGGGGAGCAGAATACCACCGCCAGGATGTTA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Bo Ram Kim et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 36(12), 9475-9486 (2015-07-01)
Bone morphogenetic proteins (BMPs) have been involved in metastatic progression and tumorigenesis of many cancer types. However, it remains unclear how BMP-2 contributes to the initiation and development of these cancers. Here, we investigated the role of BMP-2 in colon
Dawid Wnuk et al.
Scientific reports, 10(1), 16492-16492 (2020-10-07)
Airway remodelling with subepithelial fibrosis, which abolishes the physiological functions of the bronchial wall, is a major issue in bronchial asthma. Human bronchial fibroblasts (HBFs) derived from patients diagnosed with asthma display in vitro predestination towards TGF-β1-induced fibroblast-to-myofibroblast transition (FMT)
X Su et al.
Cell death & disease, 6, e1851-e1851 (2015-08-08)
MicroRNAs (miRNAs) emerge as important regulators of stem cell lineage commitment and bone development. MiRNA-26a (miR-26a) is one of the important miRNAs regulating osteogenic differentiation of both bone marrow-derived mesenchymal stem cells (BMSCs) and adipose tissue-derived mesenchymal stem cells (ADSCs).

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique