Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU050501

Sigma-Aldrich

MISSION® esiRNA

targeting human SGPL1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GATGACTGCTAAGGGGTGGAACTTGAACCAGTTGCAGTTCCCACCCAGTATTCATTTCTGCATCACATTACTACACGCCCGGAAACGAGTAGCTATACAATTCCTAAAGGACATTCGAGAATCTGTCACTCAAATCATGAAGAATCCTAAAGCGAAGACCACAGGAATGGGTGCCATCTATGGCATGGCCCAGACAACTGTTGACAGGAATATGGTTGCAGAATTGTCCTCAGTCTTCTTGGACAGCTTGTACAGCACCGACACTGTCACCCAGGGCAGCCAGATGAATGGTTCTCCAAAACCCCACTGAACTTGGACCCTTTCTAGTCTCAAGGGGATTCCAGCCTTCAGAAGGTTCTTGGGATATGGAACAGGCCGTGCACAACTTTGACATCTGGTCTTGCTCCATAGAGCACAACTCAAGATAGACCATGAGACAGCTTGAGCCTCAGG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yuxuan Zhen et al.
Journal of autoimmunity, 93, 37-44 (2018-06-14)
Glomerulonephritis (GN) is a typical lesion in autoantibody and immune complex disorders, including SLE. Because the Gas6/Axl pathway has been implicated in the pathogenesis of many types of GN, targeting this pathway might ameliorate GN. Consequently, we have studied the
Pan-Feng Feng et al.
Molecular pharmaceutics, 16(4), 1477-1488 (2019-02-27)
The hERG potassium channel (IKr) encoded by human ether-a-go-go-related gene plays an important role in cardiac repolarization. Decreased IKr may lead to long QT syndrome, which subsequently causes torsade de pointes and sudden cardiac death. Previous studies have shown that
Haifei Wang et al.
Genes & genetic systems, 93(5), 191-198 (2018-11-27)
DNA methylation is an important mediator of gene expression regulation and has been shown to be closely linked to aging. Immune-related genes tend to be influenced by DNA methylation at different ages. To explore DNA methylation changes in the porcine
Rui Yamaguchi et al.
Cytokine, 108, 24-36 (2018-03-21)
The stimuli inducing expression of single immunoglobulin IL-1-related receptor (SIGIRR) and the relevant regulatory mechanisms are not well defined. Transforming growth factor β1 (TGFβ1) delays internalization of neurokinin-1 receptor (NK1R) and subsequently enhances cellular signaling. This study investigated the effect
Qiongying Hu et al.
Molecular medicine reports, 15(3), 1335-1342 (2017-01-19)
Osteosarcoma is the most common primary bone tumor characterized by high risk of metastasis, thus presents with an overall survival rate of 60%, despite the use of chemotherapy and surgery. Metastasis‑associated lung adenocarcinoma transcript 1 (MALAT‑1) has been reported to upregulated

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique