Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU049731

Sigma-Aldrich

MISSION® esiRNA

targeting human PDS5B

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCAAGCAACCTGGAACATCTCATAACACCATTGGTTACTATTGGTCATATTGCTCTCCTTGCACCTGATCAATTTGCTGCTCCTTTGAAATCTTTGGTAGCTACTTTCATTGTGAAAGATCTTCTCATGAATGATCGGCTTCCAGGGAAAAAGACAACTAAACTTTGGGTTCCAGATGAAGAAGTATCTCCTGAGACAATGGTCAAAATTCAGGCTATTAAAATGATGGTTCGATGGCTACTTGGAATGAAAAATAATCACAGTAAATCAGGAACTTCTACCTTAAGATTGCTAACAACAATATTGCATAGTGATGGAGACTTGACAGAACAGGGGAAAATTAGTAAACCAGATATGTCACGTCTGAGACTTGCTGCTGGGAGTGCTATTGTGAAGCTGGCA

Numéro d'accès Ensembl | humain

ENSG00000083642

Numéro d'accès NCBI

NM_015032

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... PDS5B(23047) , PDS5B(23047)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Sujuan Xu et al.
Life sciences, 264, 118636-118636 (2020-11-06)
LncRNA HOXB-AS3 is proved as an oncogene in tumors. Herein, we determine the function and mechanism of HOXB-AS3 in epithelial ovarian cancer (EOC) cells. Chi-square test, Kaplan-Meier (KM) analysis and Cox regression analysis were used to analyze the clinicopathological features
Qifang Liu et al.
Infectious agents and cancer, 14, 37-37 (2019-12-14)
It has been reported that lncRNA MAGI2-AS3 can promote many types of cancer, such as breast cancer and bladder cancer, by regulating cell behaviors, such a proliferation, invasion, and migration. However, its role in cervical squamous cell carcinoma (CSCC) is
Gordana Wutz et al.
The EMBO journal, 36(24), 3573-3599 (2017-12-09)
Mammalian genomes are spatially organized into compartments, topologically associating domains (TADs), and loops to facilitate gene regulation and other chromosomal functions. How compartments, TADs, and loops are generated is unknown. It has been proposed that cohesin forms TADs and loops

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique