Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU049401

Sigma-Aldrich

MISSION® esiRNA

targeting human UCHL5

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CAACTTGCAGAGGAGGAACCCATGGATACAGATCAAGGTAATAGTATGTTAAGTGCTATTCAGTCAGAAGTTGCCAAAAATCAGATGCTTATTGAAGAAGAAGTACAGAAATTAAAAAGATACAAGATTGAGAATATCAGAAGGAAGCATAATTATCTGCCTTTCATTATGGAATTGTTAAAGACTTTAGCAGAACACCAGCAGTTAATACCACTAGTAGAAAAGGCAAAAGAAAAACAGAACGCAAAGAAAGCTCAGGAAACCAAATGAAGATGTTTTCAGATATGTACACATTTCTGCTTCTGCACATATTTTCATGGAAACCATTATGTATAAAGAACTTAGAGCAACATCCTAATTGGCTCAGTGCACGTTTGGCAATAGTGCCAGCCTGTCTTGTCT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Wonhee Han et al.
Scientific reports, 7, 42590-42590 (2017-02-16)
The Tcf/Lef family of transcription factors mediates the Wnt/β-catenin pathway that is involved in a wide range of biological processes, including vertebrate embryogenesis and diverse pathogenesis. Post-translational modifications, including phosphorylation, sumoylation and acetylation, are known to be important for the
Jieru Zhang et al.
Journal of Cancer, 11(22), 6675-6685 (2020-10-14)
Lung cancer is one of the most common malignant tumors in the world, with a high rate of malignancy and mortality. Seeking new biomarkers and potential drug targets is urgent for effective treatment of the disease. Deubiquitinase UCHL5/UCH37, as an
Susu Guo et al.
Cell death & disease, 12(1), 42-42 (2021-01-09)
The regulation of homeostasis in the Ubiquitin (Ub) proteasome system (UPS) is likely to be important for the development of liver cancer. Tribbles homolog 2 (TRIB2) is known to affect Ub E3 ligases (E3s) in liver cancer. However, whether TRIB2
Evangel Kummari et al.
PloS one, 10(8), e0135531-e0135531 (2015-08-13)
Although protein ubiquitination has been shown to regulate multiple processes during host response to Salmonella enterica serovar Typhimurium infection, specific functions of host deubiquitinating enzymes remain unknown in this bacterial infection. By using chemical proteomics approach, in which deubiquitinating enzymes

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique