Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Documents

EHU049201

Sigma-Aldrich

MISSION® esiRNA

targeting human SOX17

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CGCACGGAATTTGAACAGTATCTGCACTTCGTGTGCAAGCCTGAGATGGGCCTCCCCTACCAGGGGCATGACTCCGGTGTGAATCTCCCCGACAGCCACGGGGCCATTTCCTCGGTGGTGTCCGACGCCAGCTCCGCGGTATATTACTGCAACTATCCTGACGTGTGACAGGTCCCTGATCCGCCCCAGCCTGCAGGCCAGAAGCAGTGTTACACACTTCCTGGAGGAGCTAAGGAAATCCTCAGACTCCTGGGTTTTTGTTGTTGCTGTTGTTGTTTTTTAAAAGGTGTGTTGGCATATAATTTATGGTAATTTATTTTGTCTGCCACTTGAACAGTTTGGGGGGGTGAGGTTTCATTTAAAATTTGTTCAGAGATTTGTTTCCCATAGTTGGATTGTCAA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Eun Hee Ha et al.
The Journal of allergy and clinical immunology, 144(2), 561-573 (2019-04-01)
IL-33, levels of which are known to be increased in patients with eosinophilic asthma and which is suggested as a therapeutic target for it, activates endothelial cells in which Sry-related high-mobility-group box (Sox) 17, an endothelium-specific transcription factor, was upregulated.
Ting Zhao et al.
Cell stem cell, 23(1), 31-45 (2018-06-26)
Chemical reprogramming provides a powerful platform for exploring the molecular dynamics that lead to pluripotency. Although previous studies have uncovered an intermediate extraembryonic endoderm (XEN)-like state during this process, the molecular underpinnings of pluripotency acquisition remain largely undefined. Here, we

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique