Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EHU042151

Sigma-Aldrich

MISSION® esiRNA

targeting human KIF2A

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CAGGTTCAAGTGGTGGGATTACAGGAACGGGAGGTCAAATGTGTTGAAGATGTACTGAAACTCATTGACATAGGCAACAGTTGCAGAACATCCGGTCAAACATCTGCAAATGCACATTCATCTCGGAGCCATGCAGTGTTTCAGATTATTCTTAGAAGGAAAGGAAAACTACATGGCAAATTTTCTCTCATTGATTTGGCTGGAAATGAAAGAGGAGCTGATACTTCCAGTGCGGACAGGCAAACTAGGCTTGAAGGTGCTGAAATTAATAAAAGCCTTTTAGCACTCAAGGAGTGCATCAGAGCCTTAGGTAGAAATAAACCTCATACTCCTTTCCGTGCAAGTAAACTCACTCAGGTGTTAAGAGATTCTTTCATAGGTGAAAACTCTCGTACCTGCATGATTGC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Ming-Huang Chen et al.
Scientific reports, 6, 39337-39337 (2016-12-20)
KIF2A, a member of the kinesin-13 family, has been reported to play a role in spindle assembly in mitosis. However, its function in mammalian meiosis remains unknown. In this research, we examined the expression, localization and function of KIF2A during
Baobiao Zhuo et al.
Biochemical and biophysical research communications, 464(2), 401-406 (2015-06-28)
Accumulating evidence has shown that PI3K/Akt pathway is frequently hyperactivated in osteosarcoma (OS) and contributes to tumor initiation and progression. Altered phenotype of glucose metabolism is a key hallmark of cancer cells including OS. However, the relationship between PI3K/Akt pathway

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique