Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU040601

Sigma-Aldrich

MISSION® esiRNA

targeting human TRPA1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCTTCAGCTCTCCATTGCTTTCTATAATCCAGACCTTCAGCATGATGCTAGGAGATATCAATTATCGAGAGTCCTTCCTAGAACCATATCTGAGAAATGAATTGGCACATCCAGTTCTGTCCTTTGCACAACTTGTTTCCTTCACAATATTTGTCCCAATTGTCCTCATGAATTTACTTATTGGTTTGGCAGTTGGCGACATTGCTGAGGTCCAGAAACATGCATCATTGAAGAGGATAGCTATGCAGGTGGAACTTCATACCAGCTTAGAGAAGAAGCTGCCACTTTGGTTTCTACGCAAAGTGGATCAGAAATCCACCATCGTGTATCCCAACAAACCCAGATCTGGTGGGATGTTATTCCATATATTCTGTTTTTTATTTTGCACTGGGGAAATAAGACAAGAAATACCAAATGCTGATAAATCTTTAGAAATGGAAATATTAAAGCAGAAATACCGGCTGA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Florentina Cojocaru et al.
Scientific reports, 11(1), 2018-2018 (2021-01-23)
The transient receptor potential ankyrin type 1 (TRPA1) channel belongs to the TRP superfamily of ion channels. TRPA1 is a membrane protein with multiple functions able to respond to noxious stimuli, reactive oxygen species, inflammatory cytokines or pungent substances, and
Fabio Arturo Iannotti et al.
British journal of pharmacology, 176(10), 1568-1584 (2018-08-04)
Duchenne muscular dystrophy (DMD), caused by dystrophin deficiency, results in chronic inflammation and irreversible skeletal muscle degeneration. Moreover, the associated impairment of autophagy greatly contributes to the aggravation of muscle damage. We explored the possibility of using non-euphoric compounds present

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique