Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Documents

EHU038941

Sigma-Aldrich

MISSION® esiRNA

targeting human BMP7

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AGGCTACGCCGCCTACTACTGTGAGGGGGAGTGTGCCTTCCCTCTGAACTCCTACATGAACGCCACCAACCACGCCATCGTGCAGACGCTGGTCCACTTCATCAACCCGGAAACGGTGCCCAAGCCCTGCTGTGCGCCCACGCAGCTCAATGCCATCTCCGTCCTCTACTTCGATGACAGCTCCAACGTCATCCTGAAGAAATACAGAAACATGGTGGTCCGGGCCTGTGGCTGCCACTAGCTCCTCCGAGAATTCAGACCCTTTGGGGCCAAGTTTTTCTGGATCCTCCATTGCTCGCCTTGGCCAGGAACCAGCAGACCAACTGCCTTTTGTGAGACCTTCCCCTCCCTATCCCCAACTTTAAAGGTGTGAGAGTATTAGGAAACATGAGCAGCATATGGCTTTTG

Numéro d'accès Ensembl | humain

ENSG00000101144

Numéro d'accès NCBI

NM_001719

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... BMP7(655) , BMP7(655)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Xiaojun Ji et al.
Biological & pharmaceutical bulletin, 43(3), 533-539 (2020-03-03)
Renal interstitial fibrosis (RIF) is a common pathological characteristic associated with end-stage renal disease. However, treatment strategies for RIF are still very limited. In this study, we reported that kaempferol, a classic flavonoid, exhibited strong and widely inhibitory effect on
Maria Angelica Cortez et al.
Nature communications, 11(1), 4840-4840 (2020-09-26)
Immunotherapies revolutionized cancer treatment by harnessing the immune system to target cancer cells. However, most patients are resistant to immunotherapies and the mechanisms underlying this resistant is still poorly understood. Here, we report that overexpression of BMP7, a member of
Caixia Yuan et al.
Experimental and therapeutic medicine, 17(4), 2547-2556 (2019-03-25)
Bone morphogenetic protein (BMP) expression has been observed in the uterus in previous studies. However, the influence of BMP7 on blastocyst implantation remains unclear. Blastocysts first act on luminal endometrial epithelial cells during implantation. The purpose of the present study

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique