Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Documents

EHU037121

Sigma-Aldrich

MISSION® esiRNA

targeting human CA9

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CACTCCTGCCCTCTGACTTCAGCCGCTACTTCCAATATGAGGGGTCTCTGACTACACCGCCCTGTGCCCAGGGTGTCATCTGGACTGTGTTTAACCAGACAGTGATGCTGAGTGCTAAGCAGCTCCACACCCTCTCTGACACCCTGTGGGGACCTGGTGACTCTCGGCTACAGCTGAACTTCCGAGCGACGCAGCCTTTGAATGGGCGAGTGATTGAGGCCTCCTTCCCTGCTGGAGTGGACAGCAGTCCTCGGGCTGCTGAGCCAGTCCAGCTGAATTCCTGCCTGGCTGCTGGTGACATCCTAGCCCTGGTTTTTGGCCTCCTTTTTGCTGTCACCAGCGTCGCGTTCCTTGTGCAGATGAGAAGGCAGCACAGAAGGGGAACCAAAGGGGGTGTGAGCTACCGCCCAGCAGAGGTAGCCGAGACTGGAGCCTAGAGGCTGGATCTTGGAGAATGTGAGAAGCCAGC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... CA9(768) , CA9(768)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Martin Benej et al.
Frontiers in oncology, 10, 1462-1462 (2020-09-29)
Tumor hypoxia represents a severe microenvironmental stress that is frequently associated with acidosis. Cancer cells respond to these stresses with changes in gene expression that promote survival at least in part through pH regulation and metabolic reprogramming. Hypoxia-induced carbonic anhydrase
Kuo-Tai Hua et al.
Scientific reports, 7(1), 4466-4466 (2017-07-02)
Carbonic anhydrase IX (CA9) expression level has been considered as a poor prognostic factor in hepatocellular carcinoma (HCC) patients. However, the judging criteria of CA9 level is hard to define for potential clinical applications. Unlike CA9 expression level, CA9 polymorphism
Min-Chieh Hsin et al.
Cancers, 13(5) (2021-04-04)
Carbonic anhydrase IX (CAIX) is a hypoxia-induced protein that is highly expressed in numerous human cancers. However, the molecular mechanisms involved in CAIX and human cervical cancer metastasis remain poorly understood. In this study, CAIX overexpression in SiHa cells increased
Somayeh Jamali et al.
Scientific reports, 5, 13605-13605 (2015-09-05)
The most aggressive tumour cells, which often reside in hypoxic environments, rely on glycolysis for energy production. Thereby they release vast amounts of lactate and protons via monocarboxylate transporters (MCTs), which exacerbates extracellular acidification and supports the formation of a

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique