Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Documents

EHU035111

Sigma-Aldrich

MISSION® esiRNA

targeting human PHGDH

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GTCATCAACGCAGCTGAGAAACTCCAGGTGGTGGGCAGGGCTGGCACAGGTGTGGACAATGTGGATCTGGAGGCCGCAACAAGGAAGGGCATCTTGGTTATGAACACCCCCAATGGGAACAGCCTCAGTGCCGCAGAACTCACTTGTGGAATGATCATGTGCCTGGCCAGGCAGATTCCCCAGGCGACGGCTTCGATGAAGGACGGCAAATGGGAGCGGAAGAAGTTCATGGGAACAGAGCTGAATGGAAAGACCCTGGGAATTCTTGGCCTGGGCAGGATTGGGAGAGAGGTAGCTACCCGGATGCAGTCCTTTGGGATGAAGACTATAGGGTATGACCCCATCATTTCCCCAGAGGTCTCGGCCTCCTTTGGTGTTCAGCAGCTGCCCCTGGAGGAGATCTGGCCTCTCTGTGATTTCATCACTGTGCACACTCCTCTCCTGCCCTCCACGACAGGCTTGCTGAATGACA

Numéro d'accès Ensembl | humain

ENSG00000092621

Numéro d'accès NCBI

NM_006623

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... PHGDH(26227) , PHGDH(26227)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Wen-Bin Guo et al.
Reproductive biology and endocrinology : RB&E, 18(1), 70-70 (2020-07-16)
Although varicocele is considered to be one of the leading causes of male infertility, the precise mechanism underlying how varicocele leads to male infertility is not completely understood. We found the lactate concentration on the varicocele side of the patients
Mai Q Nguyen et al.
The Journal of investigative dermatology, 140(11), 2242-2252 (2020-05-12)
Melanomas frequently harbor activating NRAS mutations leading to activation of MAPK kinase (MEK) and extracellular signal-regulated kinase 1/2 signaling; however, the clinical efficacy of inhibitors to this pathway is limited by resistance. Tumors rewire metabolic pathways in response to stress
Amit Subedi et al.
FEBS letters, 593(8), 763-776 (2019-03-16)
Differences in the metabolism of cancer cells or cancer stem cells (CSCs) as compared to normal cells have provided avenues to safely target cancers. To discover metabolic inhibitors of CSCs, we performed alkaline phosphatase- and tumoursphere-based drug screening using induced
Stephanie Metcalf et al.
Clinical & experimental metastasis, 37(1), 187-197 (2019-10-21)
Breast cancer is the second leading cause of cancer-related deaths among women and 90% of these mortalities can be attributed to progression to metastatic disease. In particular, triple negative breast cancer (TNBC) is extremely aggressive and frequently metastasizes to multiple
Florence Polet et al.
Oncotarget, 7(2), 1765-1776 (2015-12-02)
Leukemia cells are described as a prototype of glucose-consuming cells with a high turnover rate. The role of glutamine in fueling the tricarboxylic acid cycle of leukemia cells was however recently identified confirming its status of major anaplerotic precursor in
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique