Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU034721

Sigma-Aldrich

MISSION® esiRNA

targeting human LGALS1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CTCTCGGGTGGAGTCTTCTGACAGCTGGTGCGCCTGCCCGGGAACATCCTCCTGGACTCAATCATGGCTTGTGGTCTGGTCGCCAGCAACCTGAATCTCAAACCTGGAGAGTGCCTTCGAGTGCGAGGCGAGGTGGCTCCTGACGCTAAGAGCTTCGTGCTGAACCTGGGCAAAGACAGCAACAACCTGTGCCTGCACTTCAACCCTCGCTTCAACGCCCACGGCGACGCCAACACCATCGTGTGCAACAGCAAGGACGGCGGGGCCTGGGGGACCGAGCAGCGGGAGGCTGTCTTTCCCTTCCAGCCTGGAAGTGTTGCAGAGGTGTGCATCACCTTCGACCAGGCCAACCTGACCGTCAAGCTGCCAGATGGATACGAATTCAAGTTCCCCAACCGCCTCAACCTGGAGGCCATCAACTACATGGCAGCTGACGGTGACTTCAAGATCAAATGTGTGGCCTTTGACTGAAA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Noor Al-Obaidi et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(1), 373-387 (2018-07-06)
Chronic exposure of tubular renal cells to high glucose contributes to tubulointerstitial changes in diabetic nephropathy. In the present study, we identified a new fibrosis gene called galectin-1 (Gal-1), which is highly expressed in tubular cells of kidneys of type
Bing Yan et al.
International journal of biological sciences, 12(7), 850-860 (2016-06-18)
Lung cancer is the leading cause of cancer mortality around the world. Despite advances in the targeted therapy, patients with lung squamous cell carcinoma(SCC) still benefit few from it, and the search for potential effective therapies is imperative. Here, we
Carmelo Millón et al.
The international journal of neuropsychopharmacology, 18(3) (2014-12-19)
Galanin (GAL) plays a role in mood regulation. In this study we analyzed the action of the active N-terminal fragment [GAL(1-15)] in anxiety- and depression-related behavioral tests in rats. The effect of GAL(1-15) was analyzed in the forced swimming test
Neus Martínez-Bosch et al.
Cancer research, 74(13), 3512-3524 (2014-05-09)
Despite some advances, pancreatic ductal adenocarcinoma (PDAC) remains generally refractory to current treatments. Desmoplastic stroma, a consistent hallmark of PDAC, has emerged as a major source of therapeutic resistance and thus potentially promising targets for improved treatment. The glycan-binding protein
Jie Zhu et al.
American journal of translational research, 11(6), 3862-3878 (2019-07-18)
It has been reported that Galectin-1 (Gal-1) indicates bad prognosis of patients with ovarian cancer, and Gal-1 overexpression promotes metastasis of ovarian cancer cells. Nevertheless, the underlying mechanisms of the Gal-1-mediated enhancement of metastasis are still unclear. Furthermore, little is

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique