Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EHU033021

Sigma-Aldrich

MISSION® esiRNA

targeting human ZNF609

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AAACCAACAGCCCTGCATACTCTGACATCTCTGATGCTGGGGAGGATGGGGAGGGCAAGGTAGACAGTGTCAAATCAAAGGACGCCGAACAGTTGGTTAAAGAAGGGGCTAAGAAAACTCTTTTTCCCCCTCAGCCTCAGAGCAAAGACTCACCATATTACCAAGGCTTTGAGAGTTACTATTCTCCAAGTTATGCACAGTCCAGCCCTGGGGCTCTGAACCCCAGCAGCCAGGCAGGAGTGGAGAGCCAGGCCCTGAAGACAAAAAGGGATGAGGAACCTGAGAGCATAGAAGGGAAAGTGAAGAACGATATCTGTGAAGAAAAGAAGCCCGAGCTGAGCAGTTCCAGTCAGCAGCCCTCGGTCATCCAGCAGCGTCCCAATATGTACATGCAGTCCCTGTACTACAACCAGTATGCCTATGTACCCCCCTATGGCTACAGCGACCAGAGTTACCACACCCACCTTCTGAGCACT

Numéro d'accès Ensembl | humain

ENSG00000180357

Numéro d'accès NCBI

NM_015042

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... ZNF609(23060) , ZNF609(23060)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

L Zhu et al.
European review for medical and pharmacological sciences, 23(7), 2817-2826 (2019-04-20)
This study aims to explore the biological function of circular RNA ZNF609 (circ-ZNF609) in regulating the occurrence and progression of nasopharyngeal carcinoma (NPC), and to investigate the possible underlying mechanism. The expression levels of circ-ZNF609, microRNA-150-5p and Sp1 in NPC
Yunhe Xiong et al.
Journal of cellular physiology, 234(7), 10646-10654 (2018-11-28)
Circular RNA (circRNA) play important roles in the pathological processes of many diseases. By analyzing the results of the GSE100186 chip, we found that the expression of circRNA ZNF609 (circ-ZNF609) was significantly increased in renal cell carcinoma. Recently, there are
Shaoxia Liu et al.
Journal of cellular physiology, 236(1), 79-92 (2021-01-19)
Circular RNAs (circRNAs) have been associated with lung cancer (LC), one of the most common cancers, but the underlying molecular mechanisms of the specific correlation with LC carcinogenesis remain unveiled. Quantitative real-time polymerase chain reaction was applied to examine the

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique