Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Documents

EHU031731

Sigma-Aldrich

MISSION® esiRNA

targeting human PTGER4

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGCGAGTATTCGTCAACCAGTTATATCAGCCAAGTTTGGAGCGAGAAGTCAGTAAAAATCCAGATTTGCAGGCCATCCGAATTGCTTCTGTGAACCCCATCCTAGACCCCTGGATATATATCCTCCTGAGAAAGACAGTGCTCAGTAAAGCAATAGAGAAGATCAAATGCCTCTTCTGCCGCATTGGCGGGTCCCGCAGGGAGCGCTCCGGACAGCACTGCTCAGACAGTCAAAGGACATCTTCTGCCATGTCAGGCCACTCTCGCTCCTTCATCTCCCGGGAGCTGAAGGAGATCAGCAGTACATCTCAGACCCTCCTGCCAGACCTCTCACTGCCAGACCTCAGTGAAAATGGCCTTGGAGGCAGGAATTTGCTTCCAGGTGTGCCTGGCATGGGCCTGGCCCAGGAAGACACCACCTCACTGAGGACTTTGCGAATATCAGAGACCTCAGACTCTTCACAGGGTCAGGACTCAGA

Numéro d'accès Ensembl | humain

ENSG00000171522

Numéro d'accès NCBI

NM_000958

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... PTGER4(5734) , PTGER4(5734)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Felix Tönisen et al.
European journal of cell biology, 96(2), 218-226 (2017-01-18)
The production of Prostaglandin E
Pinki Nandi et al.
BMC cancer, 17(1), 11-11 (2017-01-07)
Lymphatic metastasis, facilitated by lymphangiogenesis is a common occurrence in breast cancer, the molecular mechanisms remaining incompletely understood. We had earlier shown that cyclooxygenase (COX)-2 expression by human or murine breast cancer cells promoted lymphangiogenesis and lymphatic metastasis by upregulating
Sonja Rittchen et al.
Biochemical pharmacology, 182, 114277-114277 (2020-10-11)
Life-threatening inflammatory conditions such as acute respiratory distress syndrome or sepsis often go hand in hand with severe vascular leakage. During inflammation, endothelial cell integrity and intact barrier function are crucial to limit leukocyte and plasma extravasation. Prostaglandin D2 (PGD2)
Dingzhi Wang et al.
Gastroenterology, 149(7), 1884-1895 (2015-08-12)
Inflammation may contribute to the formation, maintenance, and expansion of cancer stem cells (CSCs), which have the capacity for self-renewal, differentiation, and resistance to cytotoxic agents. We investigated the effects of the inflammatory mediator prostaglandin E2 (PGE2) on colorectal CSC

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique