Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Documents

EHU028791

Sigma-Aldrich

MISSION® esiRNA

targeting human PDK2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CTGGACCGCTTCTACCTCAGCCGCATCTCCATCCGCATGCTCATCAACCAGCACACCCTCATCTTTGATGGCAGCACCAACCCAGCCCATCCCAAACACATCGGCAGCATCGACCCCAACTGCAACGTCTCTGAGGTGGTCAAAGATGCCTACGACATGGCTAAGCTCCTGTGTGACAAGTATTACATGGCCTCACCTGACCTGGAGATCCAGGAGATCAATGCAGCCAACTCCAAACAGCCGATTCACATGGTCTACGTCCCCTCCCACCTCTACCACATGCTCTTTGAGCTCTTCAAGAATGCCATGAGGGCGACTGTGGAAAGCCATGAGTCCAGCCTCATTCTCCCACCCATCAAGGTCATGGTGGCCTTGGGTGAGGAAGATCTGTCCATCAAGATGAGTGACCGAGGTGG

Numéro d'accès Ensembl | humain

ENSG00000005882

Numéro d'accès NCBI

NM_002611

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... PDK2(5164) , PDK2(5164)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Feifei Wei et al.
Cancer medicine, 9(7), 2480-2490 (2020-02-06)
Hepatocellular carcinoma (HCC) is one of the most deadly cancer worldwide. Multiple long noncoding RNAs (lncRNAs) are recently identified as crucial oncogenic factors or tumor suppressors. In this study, we explored the functon and mechanism of lncRNA double homeobox A
Yonggang Zhou et al.
Science translational medicine, 12(537) (2020-04-03)
Abundant decidual natural killer (dNK) cells at the maternal-fetal interface are important during early pregnancy. However, functional subsets of dNK cells remain poorly understood. We describe a CD49a+PBX homeobox 1 (PBX1)+ dNK cell subset that promotes fetal development in humans
Zhongyuan He et al.
Cell death & disease, 9(5), 505-505 (2018-05-05)
Increasing evidence indicates that dysregulation of microRNAs (miRNAs) plays a crucial role in human malignancies. Here, we showed that microRNA-422a (miR-422a) expression was dramatically downregulated in gastric cancer (GC) samples and cell lines compared with normal controls, and that its

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique