Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EHU027541

Sigma-Aldrich

MISSION® esiRNA

targeting human IMPDH2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCAGCAAGAAGGGAAAGTTGCCCATTGTAAATGAAGATGATGAGCTTGTGGCCATCATTGCCCGGACAGACCTGAAGAAGAATCGGGACTACCCACTAGCCTCCAAAGATGCCAAGAAACAGCTGCTGTGTGGGGCAGCCATTGGCACTCATGAGGATGACAAGTATAGGCTGGACTTGCTCGCCCAGGCTGGTGTGGATGTAGTGGTTTTGGACTCTTCCCAGGGAAATTCCATCTTCCAGATCAATATGATCAAGTACATCAAAGACAAATACCCTAATCTCCAAGTCATTGGAGGCAATGTGGTCACTGCTGCCCAGGCCAAGAACCTCATTGATGCAGGTGTGGATGCCCTGCGGGTGGGCATGGGAAGTGGCTCCATCTGCATTACGCAGGAAGTGCTGGCCTGTGGGCGGCCCCAAGCAACAGCAGTGTACAAGGTGTCAGAGTATGCACGGCGCTTTGGTGTTCCGGTCATTGCTGAT

Numéro d'accès Ensembl | humain

ENSG00000178035

Numéro d'accès NCBI

NM_000884

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... IMPDH2(3615) , IMPDH2(3615)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Anna Bianchi-Smiraglia et al.
Nature methods, 14(10), 1003-1009 (2017-09-05)
GTP is a major regulator of multiple cellular processes, but tools for quantitative evaluation of GTP levels in live cells have not been available. We report the development and characterization of genetically encoded GTP sensors, which we constructed by inserting
Gerson Dierley Keppeke et al.
Cell division, 13, 5-5 (2018-06-28)
Inosine monophosphate dehydrogenase (IMPDH), the rate-limiting enzyme in de novo GTP biosynthesis, plays an important role in cell metabolism and proliferation. It has been demonstrated that IMPDH can aggregate into a macrostructure, termed the cytoophidium, in mammalian cells under a

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique