Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EHU025411

Sigma-Aldrich

MISSION® esiRNA

targeting human CDH13

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AAGGGAAACGACAAGCTACGCTATGAGGTCTCGAGCCCATACTTCAAGGTGAACAGCGATGGCGGCTTAGTTGCTCTGAGAAACATAACTGCAGTGGGCAAAACTCTGTTCGTCCATGCACGGACCCCCCATGCGGAAGATATGGCAGAACTCGTGATTGTCGGGGGGAAAGACATCCAGGGCTCCTTGCAGGATATATTTAAATTTGCAAGAACTTCTCCTGTCCCAAGACAAAAGAGGTCCATTGTGGTATCTCCCATTTTAATTCCAGAGAATCAGAGACAGCCTTTCCCAAGAGATGTTGGCAAGGTAGTCGATAGTGACAGGCCAGAAAGGTCCAAGTTCCGGCTCACTGGAAAGGGAGTGGATCAAGAGCCTAAAGGAATTTTCAGAATCAATGAGAACACAGGGAGCGTCTC

Numéro d'accès Ensembl | humain

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yuya Fujishima et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 31(4), 1571-1583 (2017-01-08)
Adiponectin, an adipocyte-derived protein abundant in the circulation, is thought to be protective against atherosclerosis. However, it is not fully understood how the association of adiponectin with vascular cells and its antiatherogenic effect are connected. In this study, T-cadherin was
Yuri Tsugawa-Shimizu et al.
American journal of physiology. Endocrinology and metabolism, 320(2), E179-E190 (2020-12-08)
Adiponectin (APN) is a circulating protein specifically produced by adipocytes. Native APN specifically binds to T-cadherin, a glycosylphosphatidylinositol-anchored protein, mediating the exosome-stimulating effects of APN in endothelial, muscle, and mesenchymal stem cells. It was previously reported that APN has beneficial
Keisuke Matsuda et al.
Endocrinology, 156(3), 934-946 (2014-12-17)
Adiponectin (Adipo), a multimeric adipocyte-secreted protein abundant in the circulation, is implicated in cardiovascular protective functions. Recent work documented that Adipo locally associates with responsive tissues through interactions with T-cadherin (Tcad), an atypical, glycosylphosphatidylinositol (GPI)-anchored cadherin cell surface glycoprotein. Mice
Yuki Fujita et al.
Cell reports, 31(4), 107580-107580 (2020-04-30)
Microglia, the resident immune cells of the central nervous system, accumulate along subcerebral projection axons and support neuronal survival during the early postnatal period. It remains unknown how microglia follow an axon-specific distribution pattern to maintain neural circuits. Here, we

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique