Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Documents

EHU024991

Sigma-Aldrich

MISSION® esiRNA

targeting human ADRM1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CGGGAAAGATGTCCCTGAAGGGGACCACCGTGACTCCGGATAAGCGGAAAGGGCTGGTGTACATTCAGCAGACGGACGACTCGCTTATTCACTTCTGCTGGAAGGACAGGACGTCCGGGAACGTGGAAGACGACTTGATCATCTTCCCTGACGACTGTGAGTTCAAGCGGGTGCCGCAGTGCCCCAGCGGGAGGGTCTACGTGCTGAAGTTCAAGGCAGGGTCCAAGCGGCTTTTCTTCTGGATGCAGGAACCCAAGACAGACCAGGATGAGGAGCATTGCCGGAAAGTCAACGAGTATCTGAACAACCCCCCGATGCCTGGGGCGCTGGGGGCCAGCGGAAGCAGCGGCCACGAACTCTCTGCGCTAGGCGGTGAGGGTGGCCTGCAGAGCCTGCTGGGAAACATGAGCCACAGCCAG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Marlena S Fejzo et al.
International journal of molecular sciences, 14(2), 3094-3109 (2013-02-05)
Approximately 25,000 ovarian cancers are diagnosed in the U.S. annually, and 75% are in the advanced stage and largely incurable. There is critical need for early detection tools and novel treatments. Proteasomal ubiquitin receptor ADRM1 is a protein that is
Yiping Huang et al.
Aging, 2(12), 959-968 (2010-12-31)
Oxidative stress was shown to promote the translocation of Ataxia-telangiectasia mutated (ATM) to cytoplasm and trigger the LKB1-AMPK-tuberin pathway leading to a down-regulation of mTOR and subsequently inducing the programmed cell death II (autophagy). Cisplatin was previously found to induce

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique