Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU024691

Sigma-Aldrich

MISSION® esiRNA

targeting human CDH3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ATTGGGTGGTTGCTCCAATATCTGTCCCTGAAAATGGCAAGGGTCCCTTCCCCCAGAGACTGAATCAGCTCAAGTCTAATAAAGATAGAGACACCAAGATTTTCTACAGCATCACGGGGCCGGGGGCAGACAGCCCCCCTGAGGGTGTCTTCGCTGTAGAGAAGGAGACAGGCTGGTTGTTGTTGAATAAGCCACTGGACCGGGAGGAGATTGCCAAGTATGAGCTCTTTGGCCACGCTGTGTCAGAGAATGGTGCCTCAGTGGAGGACCCCATGAACATCTCCATCATCGTGACCGACCAGAATGACCACAAGCCCAAGTTTACCCAGGACACCTTCCGAGGGAGTGTCTTAGAGGGAGTCCTACCAGGTACTTCTGTGATGCAGGTGACAGCCACGGATGAGGATGATGCCATCTACACCTACAATGGGGTGGTTGCTTACTCCATCCATAGCCAAGAACCAAAGGACCCACACGACCTCATGTTCAC

Numéro d'accès Ensembl | humain

ENSG00000062038

Numéro d'accès NCBI

NM_001793

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... CDH3(1001) , CDH3(1001)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Li Li et al.
International journal of biological sciences, 15(5), 953-961 (2019-06-12)
P-cadherin (CDH3), a classical cell adhesion molecule involved in tissue integrity and cell localization, has been implicated in many types of cancer. However, little is known about its function and regulatory mechanism in hepatocellular carcinoma (HCC). Here we report that
A S Ribeiro et al.
Nanoscale, 8(46), 19390-19401 (2016-11-17)
Physical forces mediated by cell-cell adhesion molecules, as cadherins, play a crucial role in preserving normal tissue architecture. Accordingly, altered cadherins' expression has been documented as a common event during cancer progression. However, in most studies, no data exist linking
Ting-Feng Hsiao et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 26(13), 3220-3229 (2020-03-12)
EGFR tyrosine kinase inhibitors (EGFR-TKI) benefit patients with advanced lung adenocarcinoma (ADC) harboring activating EGFR mutations. We aimed to identify biomarkers to monitor and predict the progression of patients receiving EGFR-TKIs via a comprehensive omic analysis. We applied quantitative proteomics

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique