Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Documents

EHU022331

Sigma-Aldrich

MISSION® esiRNA

targeting human EDN1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCAAGGAGCTCCAGAAACAGCAGTCTTAGGCGCTGAGCTCAGCGCGGTGGGTGAGAACGGCGGGGAGAAACCCACTCCCAGTCCACCCTGGCGGCTCCGCCGGTCCAAGCGCTGCTCCTGCTCGTCCCTGATGGATAAAGAGTGTGTCTACTTCTGCCACCTGGACATCATTTGGGTCAACACTCCCGAGCACGTTGTTCCGTATGGACTTGGAAGCCCTAGGTCCAAGAGAGCCTTGGAGAATTTACTTCCCACAAAGGCAACAGACCGTGAAAATAGATGCCAATGTGCTAGCCAAAAAGACAAGAAGTGCTGGAATTTTTGCCAAGCAGGAAAAGAACTCAGGGCTGAAGACATTATGGAGAAAGACTGGAATAATCATAAGAAAGGAAAAGACTGTTCCAAGCTTGGGAAAAAGTGTATTTATCAGCAGTTAGTGAGAGGAAGAAAAATCAGAAGAAGTTCAGAGGAACACCTAAGACAAACCAGGTCGGAGA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yan Hao et al.
Diabetes, metabolic syndrome and obesity : targets and therapy, 14, 1405-1418 (2021-04-02)
Mesenchymal stem cell (MSC)-derived exosomes have seen great advances in human disease control in a minimally invasive manner. This research aimed to explore the function of MSC-derived exosomes in diabetic nephropathy (DN) progression and the molecules involved. A rat model
Xianwei Wang et al.
Journal of molecular and cellular cardiology, 80, 101-109 (2015-01-15)
Endothelin-1 (ET-1) plays a major role in regulating myocardial fibrosis in several pathological conditions, such as hypertension and diabetes. Aging is an independent risk factor for myocardial fibrosis. We hypothesized that ET-1 upregulation may be a basis of enhanced collagen
Shannon N Acker et al.
Pediatric research, 77(4), 511-519 (2015-01-13)
Pulmonary hypertension (PH) secondary to vascular remodeling contributes to poor outcomes in congenital diaphragmatic hernia (CDH), however mechanisms responsible are unknown. We hypothesized that pulmonary artery endothelial cell (PAEC) dysfunction contributes to smooth muscle cell (SMC) hyperplasia in experimental CDH.

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique