Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

Voir toute la documentation

EHU018231

Sigma-Aldrich

MISSION® esiRNA

targeting human SP1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme

Sélectionner une taille de conditionnement

20 μG
315,00 $
50 μG
596,00 $

315,00 $

Veuillez contacter notre Service Clients pour connaître la disponibilité de ce produit.
Toutes les photos(1)

Sélectionner une taille de conditionnement

Changer de vue
20 μG
315,00 $
50 μG
596,00 $

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

315,00 $

Veuillez contacter notre Service Clients pour connaître la disponibilité de ce produit.

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCGCTCCCAACTTACAGAACCAGCAAGTTCTGACAGGACTACCTGGAGTGATGCCTAATATTCAGTATCAAGTAATCCCACAGTTCCAGACCGTTGATGGGCAACAGCTGCAGTTTGCTGCCACTGGGGCCCAAGTGCAGCAGGATGGTTCTGGTCAAATACAGATCATACCAGGTGCAAACCAACAGATTATCACAAATCGAGGAAGTGGAGGCAACATCATTGCTGCTATGCCAAACCTACTCCAGCAGGCTGTCCCCCTCCAAGGCCTGGCTAATAATGTACTCTCAGGACAGACTCAGTATGTGACCAATGTACCAGTGGCCCTGAATGGGAACATCACCTTGCTACCTGTCAACAGCGTTTCTGCAGCTACCTTGACTCCCAGCTCTCAGGCAGTCACGATCAGCAGCTCTGGGTCCCAGGAGAGTGGCTCACAGCCTGTCACCTCAGGGACTACCATCAGTTCTGCCAGCTTGGTATCATCACAAGCCAGTTCCAGCT

Numéro d'accès Ensembl | humain

ENSG00000185591

Numéro d'accès NCBI

NM_138473

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... SP1(6667) , SP1(6667)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number
PCV
OVT
QCS
UCT
XXS

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Rechercher un(e) COA

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yuehua Zhao et al.
Molecular medicine reports, 16(2), 2191-2198 (2017-06-20)
Research into the expression and function of microRNAs (miRNAs/miR) in human cancer has provided novel insights into the molecular mechanisms underlying carcinogenesis and cancer progression. Aberrant miRNA expression has been reported in retinoblastoma (RB) and several other types of human
Lili Lv et al.
Oncology research, 26(5), 775-783 (2017-12-16)
Cervical cancer is the third most commonly diagnosed malignancy and the fourth leading cause of cancer-related deaths in women worldwide. MicroRNA-296 (miR-296) is aberrantly expressed in a variety of human cancer types. However, the expression levels, biological roles, and underlying
Jingnan Liu et al.
Human molecular genetics, 25(4), 672-680 (2016-01-09)
Mutations in leucine-rich repeat kinase 2 (LRRK2) cause autosomal-dominant Parkinsonism with pleomorphic pathology including deposits of aggregated protein and neuronal degeneration. The pathogenesis of LRRK2-linked Parkinson's disease (PD) is not fully understood. Here, using co-immunoprecipitation, we found that LRRK2 interacted
Jie Qi et al.
Journal of diabetes research, 2020, 2308520-2308520 (2020-03-19)
Cyclooxygenase 2 (COX2) and inducible nitric oxide synthase (iNOS) overexpression results in endothelial apoptosis, thus mediating vascular endothelial injury in hyperglycaemia. E26 transformation-specific sequence transcription factor-1 (ESE-1), which belongs to the E26 transformation-specific family of transcription factors, has been demonstrated
Im-Kyung Kim et al.
Scientific reports, 9(1), 5933-5933 (2019-04-13)
Specific protein 1 (SP1) is associated with aggressive behavior, invasive clinical phenotype and poor clinical outcomes in various cancers. We studied whether SP1 exerts its effect on invasiveness and promotion of the epithelial-mesenchymal transition (EMT) by regulating lysyl oxidase-like 2
Afficher tous les articles scientifiques apparentés

Questions

Reviews

No rating value

Active Filters

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique