Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Documents

EHU016311

Sigma-Aldrich

MISSION® esiRNA

targeting human KCNH8

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TCCAGATGAACTGCGTTCTGACATCACTATGCACTTGAACAAGGAGATCTTACAGTTGTCCCTTTTTGAATGTGCCAGCCGGGGCTGCCTCAGGTCTCTGTCTCTACACATCAAAACCTCTTTCTGTGCTCCGGGGGAGTATCTGCTGCGTCAAGGGGATGCTTTGCAGGCCATCTACTTTGTATGCTCGGGCTCCATGGAAGTTCTTAAAGACAGCATGGTGCTGGCTATTCTTGGGAAAGGGGATTTAATTGGAGCAAATCTATCAATTAAGGACCAAGTGATCAAGACCAATGCAGATGTAAAGGCTTTAACCTACTGTGATCTCCAGTGTATCATCCTCAAAGGACTCTTTGAAGTGCTAGACCTTTACCCAGAATATGCTCACAAATTCGTGGAAGACATTCAGCATGACCTCACATACAACCTCCGAGAAGGTCATGAGAGTGATGTGATATCAAGACTATCAAACAAATCTATGGTCTCACAGTCAGAGCCCAAGGGAAAT

Numéro d'accès Ensembl | humain

ENSG00000183960

Numéro d'accès NCBI

NM_144633

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... KCNH8(131096) , KCNH8(131096)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Chrisostomos Chrisostomidis et al.
International journal of dermatology, 54(9), 989-995 (2015-07-16)
The aim of this study was to investigate if the expression of CD105 and Ets-1 was predictive of aggressive biologic behavior of non-melanoma skin cancers (NMSC) and to evaluate indicators of local recurrence. A total of 144 patients with NMSC
Velidi H Rao et al.
American journal of physiology. Heart and circulatory physiology, 309(6), H1075-H1086 (2015-08-09)
Although degradation of extracellular matrix by matrix metalloproteinases (MMPs) is thought to be involved in symptomatic (S) carotid plaques in atherosclerosis, the mechanisms of MMP expression are poorly understood. Here, we demonstrate that collagen loss in vascular smooth vessel cells
E Douglas Robertson et al.
PloS one, 9(11), e113050-e113050 (2014-11-18)
The molecular response to hypoxia is a critical cellular process implicated in cancer, and a target for drug development. The activity of the major player, HIF1α, is regulated at different levels by various factors, including the transcription factor ELK3. The

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique