Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Documents

EHU014011

Sigma-Aldrich

MISSION® esiRNA

targeting human TRPV2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TCAGTGCTGGAGATCATTGCCTTTCATTGCAAGAGCCCGCACCGACACCGAATGGTCGTTTTGGAGCCCCTGAACAAACTGCTGCAGGCGAAATGGGATCTGCTCATCCCCAAGTTCTTCTTAAACTTCCTGTGTAATCTGATCTACATGTTCATCTTCACCGCTGTTGCCTACCATCAGCCTACCCTGAAGAAGGGCGCCGCCCCTCACCTGAAAGCGGAGGTTGGAAACTCCATGCTGCTGACGGGCCACATCCTTATCCTGCTAGGGGGGATCTACCTCCTCGTGGGCCAGCTGTGGTACTTCTGGCGGCGCCACGTGTTCATCTGGATCTCGTTCATAGACAGCTACTTTGAAATCCTCTTCCTGTTCCAGGCCCTGCTCACAGTGGTGTCCCAGGTGCTGTGTTTCCTGGCCATCGAGTGGTACCTGCCCCTGCTTGTGTCTGCGCTGGTGCTGGGCTGGCTGAACCTGCTTTACTATACACGTGGCTTCCAGCACACAGGCATCTAC

Numéro d'accès Ensembl | humain

ENSG00000187688

Numéro d'accès NCBI

NM_016113

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... TRPV2(51393) , TRPV2(51393)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Agathe Oulidi et al.
PloS one, 8(5), e64885-e64885 (2013-06-07)
Adrenomedullin (AM) is a 52-amino acid peptide initially isolated from human pheochromocytoma. AM is expressed in a variety of malignant tissues and cancer cell lines and was shown to be a mitogenic factor capable of stimulating growth of several cancer
Taro Ishii et al.
Journal of dermatological science, 90(3), 332-342 (2018-04-04)
Keratinocytes release several factors that are involved in wound contracture and scar formation. We previously reported that a three-dimensional reconstruction model derived from rat skin represents a good wound healing model. We characterized the role of transient receptor potential (TRP)
Michal Entin-Meer et al.
PloS one, 9(8), e105055-e105055 (2014-08-20)
A novel family of transient receptor potential (TRP) channels, that may hold a role in calcium homeostasis, has recently been described. By employing a GeneChip array analysis we have demonstrated a clear and specific upregulation of the TRP vanilloid 2
Matthew R Cohen et al.
PloS one, 8(12), e85392-e85392 (2014-01-07)
Transient receptor potential vanilloid 2 (TRPV2) is a Ca(2+)-permeable nonselective cation channel proposed to play a critical role in a wide array of cellular processes. Although TRPV2 surface expression was originally determined to be sensitive to growth factor signaling, regulated
Toshiaki Sawatani et al.
American journal of physiology. Cell physiology, 316(3), C434-C443 (2019-01-17)
β-Cell swelling induces membrane depolarization, which has been suggested to be caused at least partly by the activation of cation channels. Here, we show the identification of the cation channels. In isolated mouse pancreatic β-cells, the exposure to 30% hypotonic
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique