Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU012071

Sigma-Aldrich

MISSION® esiRNA

targeting human LPL

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AAGAACCGCTGCAACAATCTGGGCTATGAGATCAATAAAGTCAGAGCCAAAAGAAGCAGCAAAATGTACCTGAAGACTCGTTCTCAGATGCCCTACAAAGTCTTCCATTACCAAGTAAAGATTCATTTTTCTGGGACTGAGAGTGAAACCCATACCAATCAGGCCTTTGAGATTTCTCTGTATGGCACCGTGGCCGAGAGTGAGAACATCCCATTCACTCTGCCTGAAGTTTCCACAAATAAGACCTACTCCTTCCTAATTTACACAGAGGTAGATATTGGAGAACTACTCATGTTGAAGCTCAAATGGAAGAGTGATTCATACTTTAGCTGGTCAGACTGGTGGAGCAGTCCCGGCTTCGCCATTCAGAAGATCAGAGTAAAAGCAGGAGAGACTCAGAAAAAGGTGATCTTCTGTTCTAGGGAGAAAGTGTCTCATTTGCAGAAAGGAAAGGCACCTGCGGTATTTGTGAAATGCCATGACAAGTCTCTGAATAAGAAGTCAGGCTGAAACTGGG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Majib Jan et al.
Biochemical and biophysical research communications, 462(1), 33-37 (2015-05-02)
In previous studies, we demonstrated that down-regulation of lipoprotein lipase in L6 muscle cells increased insulin-stimulated glucose uptake. In the current study, we used RNA interference technology to silence the LPL gene in L6 cells and generate a LPL-knock-down (LPL-KD)
Ping-Ping He et al.
Biochimie, 106, 81-90 (2014-08-26)
Accumulating evidence suggests that microRNA-590 (miR-590) has protective effects on cardiovascular diseases, but the mechanism is unknown. Interestingly, previous studies from our laboratory and others have shown that macrophage-derived lipoprotein lipase (LPL) might accelerate atherosclerosis by promoting lipid accumulation and
Uri Rozovski et al.
Molecular cancer research : MCR, 13(5), 944-953 (2015-03-04)
While reviewing chronic lymphocytic leukemia (CLL) bone marrow slides, we identified cytoplasmic lipid vacuoles in CLL cells but not in normal B cells. Because lipoprotein lipase (LPL), which catalyzes hydrolysis of triglycerides into free fatty acids (FFA), is aberrantly expressed

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique