Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

View All Documentation

EHU006461

Sigma-Aldrich

MISSION® esiRNA

targeting human FLCN

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CTGGCCTGAGCAAGACCTACAAGTCACACCTCATGTCCACGGTCCGCAGCCCCACAGCCTCGGAGTCTCGGAACTGACCCGTCACACACACCTGCCTAAAGACAGGGATGGCTGTCCACAGGATCCTCCAGCCCCGTGAGAGGGACTGTCCCTTGAGTTTCTCAACTGCTGGAAGGAGCTGTGTCCCAGCAAGGAAGGGAAACCATCAGGGCTGGGCTCGGCCCTGTCAGGTTTGGGGCCTGTGTGCTTCCCAGACTCTCCCTCCAGCCGTTGGAATCGCTGAAGATGGCAATGAAAGGCGGAGGGATGATGGGCTCTCTCTGTGTTCAAACTCCTTGGAGAGACGACTAGGAGGACAGCTTGCCTCCCAGGCCCCTTGTGGACTTAGACTCAAAACCCGCAGGAGAAACAGGTCCGACTCAGTATGCAGTCGCAATAACATGTCTGCTCCCGAGGTTAACATTCAAGCGTTTCTACTTTGAAATTCAGCAAGAGTTTCTGGGCCTTATGTTTGAGGGTACCTTTTGCTGCAGTTGTGAA

Numéro d'accès Ensembl | humain

ENSG00000154803

Numéro d'accès NCBI

NM_144606
NM_144997

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... FLCN(201163) , FLCN(201163)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Malte P Bartram et al.
BMC medical genetics, 18(1), 53-53 (2017-05-14)
Renal cell carcinoma is among the most prevalent malignancies. It is generally sporadic. However, genetic studies of rare familial forms have led to the identification of mutations in causative genes such as VHL and FLCN. Mutations in the FLCN gene
Seung-Beom Hong et al.
PloS one, 5(12), e15793-e15793 (2011-01-07)
Germline mutations in a tumor suppressor gene FLCN lead to development of fibrofolliculomas, lung cysts and renal cell carcinoma (RCC) in Birt-Hogg-Dubé syndrome. TFE3 is a member of the MiTF/TFE transcription factor family and Xp11.2 translocations found in sporadic RCC
Leeanna El-Houjeiri et al.
Cell reports, 26(13), 3613-3628 (2019-03-28)
TFEB and TFE3 are transcriptional regulators of the innate immune response, but the mechanisms regulating their activation upon pathogen infection are poorly elucidated. Using C. elegans and mammalian models, we report that the master metabolic modulator 5'-AMP-activated protein kinase (AMPK) and

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique