Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Documents

EHU005441

Sigma-Aldrich

MISSION® esiRNA

targeting human FLT1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ATGGTCTTTGCCTGAAATGGTGAGTAAGGAAAGCGAAAGGCTGAGCATAACTAAATCTGCCTGTGGAAGAAATGGCAAACAATTCTGCAGTACTTTAACCTTGAACACAGCTCAAGCAAACCACACTGGCTTCTACAGCTGCAAATATCTAGCTGTACCTACTTCAAAGAAGAAGGAAACAGAATCTGCAATCTATATATTTATTAGTGATACAGGTAGACCTTTCGTAGAGATGTACAGTGAAATCCCCGAAATTATACACATGACTGAAGGAAGGGAGCTCGTCATTCCCTGCCGGGTTACGTCACCTAACATCACTGTTACTTTAAAAAAGTTTCCACTTGACACTTTGATCCCTGATGGAAAACGCATAATCTGGGACAGTAGAAAGGGCTTCATCATATCAAATGCAACGTACAAAGAAATAGGGCTTCTGACCTGTGAAGCAACAGTCAATGGGCATTTGTATAAGACAAACTATCTCACACATCGACAAACCAATACAATCATAGATGTCCAAATAAGCACACCACGCCCAGTCAAATTAC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

12 - Non Combustible Liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Jaewoo Hong et al.
Cancers, 12(6) (2020-05-31)
The vascular response to hypoxia and ischemia is essential for maintaining homeostasis during stressful conditions and is particularly critical for vital organs such as the heart. Hypoxia-inducible factor-1 (HIF-1) is a central regulator of the response to hypoxia by activating
Jun Yu et al.
Placenta, 58, 1-8 (2017-10-01)
Excessive circulating sFlt1 plays a major role in the pathogenesis of preeclampsia (PE). Using RNAi to silence sFlt1 may be a therapy for treating PE. Because of the rapid degradation of siRNA, gene therapy in vivo remains limited. Poly-amidoamine (PAMAM) has
Ramcharan Singh Angom et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(3), 4626-4637 (2018-12-24)
Aggregated amyloid β (Aβ) peptides in the Alzheimer's disease (AD) brain are hypothesized to trigger several downstream pathologies, including cerebrovascular dysfunction. Previous studies have shown that Aβ peptides can have antiangiogenic properties, which may contribute to vascular dysfunction in the
Jessica E Nesmith et al.
Development (Cambridge, England), 144(5), 889-896 (2017-03-02)
Blood vessel formation is essential for vertebrate development and is primarily achieved by angiogenesis - endothelial cell sprouting from pre-existing vessels. Vessel networks expand when sprouts form new connections, a process whose regulation is poorly understood. Here, we show that
San Xu et al.
Oncology reports, 40(1), 377-384 (2018-05-12)
The Epstein-Barr virus latent membrane protein 1 (EBV‑LMP1) is an oncoviral protein that plays an important role in oncogenic transformation in EBV‑associated nasopharyngeal carcinoma (NPC). Our previous studies demonstrated that LMP1 increased VEGFA expression and upregulated angiogenesis in NPC. Vasculogenic mimicry (VM)

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique