Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU004761

Sigma-Aldrich

MISSION® esiRNA

targeting human CYP27B1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGAAATTCTCGTGTCCCAGACAAAGACATTCATGTGGGTGACTATATTATCCCCAAAAATACGCTGGTCACTCTGTGTCACTATGCCACTTCAAGGGACCCTGCCCAGTTCCCAGAGCCAAATTCTTTTCGTCCAGCTCGCTGGCTGGGGGAGGGTCCCACCCCCCACCCATTTGCATCTCTTCCCTTTGGCTTTGGCAAGCGCAGCTGTATGGGGAGACGCCTGGCAGAGCTTGAATTGCAAATGGCTTTGGCCCAGATCCTAACACATTTTGAGGTGCAGCCTGAGCCAGGTGCGGCCCCAGTTAGACCCAAGACCCGGACTGTCCTGGTACCTGAAAGGAGCATCAACCTACAGTTTTTGGACAGATAGTCCCATGGAAAGAGACTGTCATCATCACCCTTTCATTCATCATAGGGATAAGATTTTTTGTAGGCACAAGACCAAGGTATACATCTTCCCCTAATGCCTATCTGACCAAACTGGATAGAACCACCATAGTGAAGTGTGAGGCGGCCCTGACCAATGTGTGAAGTATGCACTTGGCCTG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Hana Sustova et al.
Acta physiologica (Oxford, England), 226(3), e13269-e13269 (2019-03-06)
Loss of skeletal muscle is one of the main features of cancer cachexia. Vitamin D (VD) deficiency is associated with impairment of muscle mass and performance and is highly prevalent in cachectic patients; therefore, VD supplementation has been proposed to
Shuo Geng et al.
Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research, 26(5), 1145-1153 (2011-05-05)
1,25-Dihydroxyvitamin D(3)[1,25(OH)(2)D(3)] has many noncalcemic actions that rest on inhibition of proliferation and promotion of differentiation in malignant and normal cell types. 1,25(OH)(2)D(3) stimulates osteoblast differentiation of human marrow stromal cells (hMSCs), but little is known about the effects of
Kaining Liu et al.
PloS one, 7(6), e39878-e39878 (2012-07-05)
We previously demonstrated that 25-hydroxyvitamin D(3), the precursor of 1α,25-dihydroxyvitamin D(3), is abundant around periodontal soft tissues. Here we investigate whether 25-hydroxyvitamin D(3) is converted to 1α,25-dihydroxyvitamin D(3) in periodontal soft tissue cells and explore the possibility of an autocrine/paracrine
Ken-ichiro Tanaka et al.
Biochemical and biophysical research communications, 450(1), 482-487 (2014-06-14)
Vitamin D deficiency and advanced glycation end products (AGEs) are suggested to be involved in the pathogenesis of osteoporosis and sarcopenia. However, the effects of vitamin D and AGEs on myogenesis and the interaction between muscle and bone remains still
Lars Brodowski et al.
PloS one, 9(6), e98527-e98527 (2014-06-03)
Placenta-derived circulating factors contribute to the maternal endothelial dysfunction underlying preeclampsia. Endothelial colony forming cells (ECFC), a sub-population of endothelial progenitor cells (EPCs), are thought to be involved in vasculogenesis and endothelial repair. Low vitamin D concentrations are associated with

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique