Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU004071

Sigma-Aldrich

MISSION® esiRNA

targeting human CYP2E1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ACGTCATAGCCGACATCCTCTTCCGCAAGCATTTTGACTACAATGATGAGAAGTTTCTAAGGCTGATGTATTTGTTTAATGAGAACTTCCACCTACTCAGCACTCCCTGGCTCCAGCTTTACAATAATTTTCCCAGCTTTCTACACTACTTGCCTGGAAGCCACAGAAAAGTCATAAAAAATGTGGCTGAAGTAAAAGAGTATGTGTCTGAAAGGGTGAAGGAGCACCATCAATCTCTGGACCCCAACTGTCCCCGGGACCTCACCGACTGCCTGCTCGTGGAAATGGAGAAGGAAAAGCACAGTGCAGAGCGCTTGTACACAATGGACGGTATCACCGTGACTGTGGCCGACCTGTTCTTTGCGGGGACAGAGACCACCAGCACAACTCTGAGATATGGGCTCCTGATTCTCATGAAATACCCTGAGATTGAAGAGAAGCTCCATGAAGAAATTGACAGGGTGATTGGGCCAAGCCGAATCCCTGCCATCAAGGATAGGCAAGAGATGCCCTACATGGATGCTGTGGTGCATGAGATTCAGCGGTTCATCACC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yoshio Ijiri et al.
Xenobiotica; the fate of foreign compounds in biological systems, 48(1), 60-72 (2017-01-14)
1. Drug-induced liver injury is difficult to predict at the pre-clinical stage. This study aimed to clarify the roles of caspase-8 and -9 in CYP2E1 metabolite-induced liver injury in both rats and cell cultures in vitro treated with carbon tetrachloride (CCl
Beomseok Son et al.
American journal of physiology. Lung cellular and molecular physiology, 313(5), L916-L929 (2017-08-12)
Radiation-induced pulmonary fibrosis (RIPF) is one of the most common side effects of lung cancer radiotherapy. This study was conducted to identify the molecular mechanism responsible for RIPF. We revealed that the transcriptional level of cytochrome P450 2E1 (CYP2E1) was
Lu Li et al.
International journal of oncology, 50(5), 1832-1838 (2017-03-25)
Although vitamin K2 (VK2) exhibits inhibitory effects on the viability of hepatoma cells, hepatoma cells are insensitive to VK2. Therefore, this investigation is an attempt to enhance the sensitivity of hepatoma cells to VK2. Our results showed that VK2 acted
Liliana Mancio-Silva et al.
Cell metabolism, 29(3), 727-735 (2019-03-07)
The liver plays a central role in metabolism; however, xenobiotic metabolism variations between human hepatocytes and those in model organisms create challenges in establishing functional test beds to detect the potential drug toxicity and efficacy of candidate small molecules. In
Dahlia Triningsih et al.
Toxicology in vitro : an international journal published in association with BIBRA, 72, 105105-105105 (2021-02-06)
Acrylamide is known as a neurotoxicant found in commonly consumed food as well as in human body. However, the underlying mechanisms involved in neurotoxicity by acrylamide and its metabolite, glycidamide remain largely unknown. In this study, we have examined the

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique