Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU002301

Sigma-Aldrich

MISSION® esiRNA

targeting human ITGAV

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ATTCCACTGCAGGCTGATTTCATCGGGGTTGTCCGAAACAATGAAGCCTTAGCAAGACTTTCCTGTGCATTTAAGACAGAAAACCAAACTCGCCAGGTGGTATGTGACCTTGGAAACCCAATGAAGGCTGGAACTCAACTCTTAGCTGGTCTTCGTTTCAGTGTGCACCAGCAGTCAGAGATGGATACTTCTGTGAAATTTGACTTACAAATCCAAAGCTCAAATCTATTTGACAAAGTAAGCCCAGTTGTATCTCACAAAGTTGATCTTGCTGTTTTAGCTGCAGTTGAGATAAGAGGAGTCTCGAGTCCTGATCATGTCTTTCTTCCGATTCCAAACTGGGAGCACAAGGAGAACCCTGAGACTGAAGAAGATGTTGGGCCAGTTGTTCAGCACATCTATGAGCTGAGAAACAATGGTCCAAGTTCATTCAGCAAGGCA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Chuyue Zhang et al.
ACS nano, 14(9), 12133-12147 (2020-08-14)
Extracellular vesicles (EVs) derived from mesenchymal stem cells (MSC-EVs) have been recognized as a promising cell-free therapy for acute kidney injury (AKI), which avoids safety concerns associated with direct cell engraftment. However, low stability and retention of MSC-EVs have limited
Bin Zhang et al.
Cancer letters, 459, 204-215 (2019-06-15)
Macrophage-targeted therapy offers new options for intractable pancreatic ductal adenocarcinoma (PDAC), which has a low 5-year survival rate. However, the factors regulating the biological function and phenotype of macrophages in PDAC are incompletely understood. Here, we found that CD51 was
Weikun Xiao et al.
Matrix biology : journal of the International Society for Matrix Biology, 85-86, 128-146 (2019-04-28)
Originating in the brain, glioblastoma (GBM) is a highly lethal and virtually incurable cancer, in large part because it readily develops resistance to treatments. While numerous studies have investigated mechanisms enabling GBM cells to evade chemotherapy-induced apoptosis, few have addressed
Huashe Wang et al.
Pathology, research and practice, 215(9), 152531-152531 (2019-07-20)
Integrin subunit alpha V (ITGAV), a member of integrin family of extracellular matrix receptors, is involved in many types of cancer. In this study, the expression levels, clinical features and prognosis of ITGAV in gastric cancer (GC) patients were investigated
Hanan S Elsarraj et al.
NPJ breast cancer, 6, 12-12 (2020-05-01)
The molecular processes by which some human ductal carcinoma in situ (DCIS) lesions advance to the more aggressive form, while others remain indolent, are largely unknown. Experiments utilizing a patient-derived (PDX) DCIS Mouse INtraDuctal (MIND) animal model combined with ChIP-exo

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique