Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU002061

Sigma-Aldrich

MISSION® esiRNA

targeting human TAAR1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme

Sélectionner une taille de conditionnement

20 μG
315,00 $
50 μG
596,00 $

315,00 $


Veuillez contacter notre Service Clients pour connaître la disponibilité de ce produit.


Sélectionner une taille de conditionnement

Changer de vue
20 μG
315,00 $
50 μG
596,00 $

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

315,00 $


Veuillez contacter notre Service Clients pour connaître la disponibilité de ce produit.

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CAGCCTCCATTTTCCATTTGTCTTTCATCTCCATTGACCGCTACTATGCTGTGTGTGATCCACTGAGATATAAAGCCAAGATGAATATCTTGGTTATTTGTGTGATGATCTTCATTAGTTGGAGTGTCCCTGCTGTTTTTGCATTTGGAATGATCTTTCTGGAGCTAAACTTCAAAGGCGCTGAAGAGATATATTACAAACATGTTCACTGCAGAGGAGGTTGCTCTGTCTTCTTTAGCAAAATATCTGGGGTACTGACCTTTATGACTTCTTTTTATATACCTGGATCTATTATGTTATGTGTCTATTACAGAATATATCTTATCGCTAAAGAACAGGCAAGATTAATTAGTGATGCCAATCAGAAGCTCCAAATTGGATTGGAAATGAAAAATGGAATTTCACAAAGCAAAGAAAGGAAAGCTGTGAAGACATTGGGGAT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Mallory S Pitts et al.
Histochemistry and cell biology, 152(2), 155-166 (2019-05-22)
Trace amine-associated receptors are G protein-coupled receptors of which TAAR1 is the most well-studied. Recently, Vattai et al. (J Cancer Res Clin Oncol 143:1637-1647 https://doi.org/10.1007/s00432-017-2420-8 , 2017) reported that expression of TAAR1 may be a marker of breast cancer (BC)
Uma Sriram et al.
Journal of leukocyte biology, 99(1), 213-223 (2015-08-26)
The novel transmembrane G protein-coupled receptor, trace amine-associated receptor 1 (TAAR1), represents a potential, direct target for drugs of abuse and monoaminergic compounds, including amphetamines. For the first time, our studies have illustrated that there is an induction of TAAR1
D Almeida-Santos et al.
Journal of molecular neuroscience : MN, 71(3), 625-637 (2020-08-21)
The choroid plexus (CP) constitutes a barrier between the blood and the cerebrospinal fluid (CSF) which regulates the exchange of substances between these two fluids through mechanisms that are not completely understood. Polyamines as spermine, spermidine and putrescine are produced

Questions

Reviews

No rating value

Active Filters

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique