Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EHU001951

Sigma-Aldrich

MISSION® esiRNA

targeting human REL

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCCCATCTCAAGTGGATTGTCACATCATGCCTCAATGGCACCTCTGCCTTCTTCAAGCTGGTCATCAGTGGCCCACCCCACCCCACGCTCAGGCAATACAAACCCACTGAGTAGTTTTTCAACAAGGACACTTCCTTCTAATTCGCAAGGTATCCCACCATTCCTGAGAATACCTGTTGGGAATGATTTAAATGCTTCTAATGCTTGCATTTACAACAATGCCGATGACATAGTCGGAATGGAAGCGTCATCCATGCCATCAGCAGATTTATATGGTATTTCTGATCCCAACATGCTGTCTAATTGTTCTGTGAATATGATGACAACCAGCAGTGACAGCATGGGAGAGACTGATAATCCAAGACTTCTGAGCATGAATCTTGAAAACCCCTCATGTAATTCAGTGTTAGACCCAAGAGACTTGAGACAGCTCCATCAGATGTCCTCTTCCAGTATGTCAGCAGGCGCCAATTCCAATACTACTGTTTTTGTTTCACAATCAGATGCATTTGAGGGATCTGACTTCAGTTGTGCAGATAACAGCATGATAAATGAGTCGGGACCATCAA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Seyedeh Momeneh Mohammadi et al.
Leukemia research, 61, 53-61 (2017-09-12)
The c-Rel transcription factor is a unique member of the NF-kB family that has a role in apoptosis, proliferation and cell survival. Overexpression of c-Rel is detected in many human B cell tumors, including B-cell leukemia and several cancers. The
Xiaodong Lai et al.
Oncology reports, 36(6), 3651-3656 (2016-10-26)
miR‑574‑5p has been reported involved in the pathogenesis of numerous human malignancies such as colorectal and lung cancer. In this study, we aimed to explore the roles of REL and miR‑574 in the recurrence of prostate cancer (PCa) and to identify
Shayna E Thomas-Jardin et al.
The Prostate, 80(2), 133-145 (2019-11-16)
The androgen receptor (AR) nuclear transcription factor is a therapeutic target for prostate cancer (PCa). Unfortunately, patients can develop resistance to AR-targeted therapies and progress to lethal disease, underscoring the importance of understanding the molecular mechanisms that underlie treatment resistance.

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique