Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EMU210991

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Hras1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GATTGGCAGCCGCTGTAGAAGCTATGACAGAATACAAGCTTGTGGTGGTGGGCGCTGGAGGCGTGGGAAAGAGTGCCCTGACCATCCAGCTGATCCAGAACCACTTTGTGGACGAGTATGATCCCACTATAGAGGACTCCTACCGGAAACAGGTGGTCATTGATGGGGAGACATGTCTACTGGACATCTTAGACACAGCAGGTCAAGAAGAGTATAGTGCCATGCGGGACCAGTACATGCGCACAGGGGAGGGCTTCCTCTGTGTATTTGCCATCAACAACACCAAGTCCTTCGAGGACATCCATCAGTACA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jagadish Loganathan et al.
International journal of oncology, 44(6), 2009-2015 (2014-04-11)
Breast cancer metastasis is one of the major reasons for the high morbidity and mortality of breast cancer patients. In spite of surgical interventions, chemotherapy, radiation therapy and targeted therapy, some patients are considering alternative therapies with herbal/natural products. In
Fanjie Meng et al.
Oncology reports, 32(5), 2023-2030 (2014-09-06)
Ras mutations contribute to human cancer development. The present study assessed the Ras V12 mutation in hepatocellular carcinoma (HCC) cells and the role of its silencing in vitro and in nude mouse xenografts. HCC BEL7402 cells expressed mutations of V12 (Val/Gly)
Francesco Baschieri et al.
Nature communications, 5, 4839-4839 (2014-09-12)
The small GTPase Cdc42 is a key regulator of polarity, but little is known in mammals about its spatial regulation and the relevance of spatial Cdc42 pools for polarity. Here we report the identification of a GM130-RasGRF complex as a
J Hun Hah et al.
Head & neck, 36(11), 1547-1554 (2013-10-15)
The purpose of this study was to identify mechanisms of innate resistance to an epidermal growth factor receptor (EGFR) tyrosine kinase inhibitor, erlotinib, in a panel of head and neck squamous cell carcinoma (HNSCC) cell lines. Specifically, we analyzed the
Sushmita Chakraborty et al.
Journal of immunology (Baltimore, Md. : 1950), 194(8), 3852-3860 (2015-03-20)
Leishmania major is a parasite that resides and replicates in macrophages. We previously showed that the parasite enhanced CD40-induced Raf-MEK-ERK signaling but inhibited PI3K-MKK-p38MAPK signaling to proleishmanial effects. As Raf and PI3K have a Ras-binding domain but exert opposite effects

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service