Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EMU195691

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Emc1

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
$254.00
50 μG
$480.00

$254.00


Please contact Customer Service for Availability


Select a Size

Change View
20 μG
$254.00
50 μG
$480.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

$254.00


Please contact Customer Service for Availability

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATCCCAACAGAGCAAAGCAGAGAAGAGAACCTGATCCCATATTCTCCAGATGTTCAGGTCCATGCAGAGCGATTCATCAACTATAACCAGACAGTCTCTCGAATGCGAGGCATCTATACAGCGCCCTCAGGCCTGGAGTCCACTTGTTTGGTTGTGGCCTACGGTTTGGATATTTACCAAACTCGAGTTTACCCGTCCAAGCAGTTTGATGTCCTGAAAGATGACTACGACTATGTGCTCATCAGCAGTGTCCTTTTTGGCCTGGTTTTTGCCACCATGATCACAAAGAGGCTGGCACAGGTGAAACTCCTCAATCGAGCCTGGCGGTAAAATGGGAGCACCGTGCCAGAGTGGAGCCTCGGGAAGAGGGACAGCTAAGGAGATGGCCGTGGACTGTTGGATCCCTGAGGTTGGGCTGGGCTCTTGTCTCACTTACGTCTGGGAGAAGAAGGTGCACCTTCATGGAGAAGTGCTTCGGGAACACGGTGACGAACAGTTCTTGTGGTCAGATACCCACC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Wen-feng Gou et al.
BMC cancer, 14, 477-477 (2014-07-06)
RhoC is a small G protein/GTPase and involved in tumor mobility, invasion and metastasis. Previously, up-regulated RhoC expression is found to play an important role in ovarian carcinogenesis and subsequent progression by modulating proliferation, apoptosis, migration and invasion. We transfected
Jian Ma et al.
Veterinary research, 45, 82-82 (2014-08-12)
The Chinese attenuated equine infectious anemia virus (EIAV) vaccine has successfully protected millions of equine animals from EIA disease in China. Given that the induction of immune protection results from the interactions between viruses and hosts, a better understanding of
Dao Chao Huang et al.
Endocrinology, 155(10), 3739-3749 (2014-07-23)
The role of PTHrP in the highly metastatic human melanoma disease is not known. This study investigates the mechanisms of action of this secreted factor through homozygous inactivation of the Pthrp gene in A375 human melanoma cells. In vitro, Pthrp-ablated

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service