Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EMU023971

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Zeb1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GATGCAGCTGACTGTGAAGGTGGCATGCCAGATGATGAACTGCCAGCAGACCAGACAGTATTACCAGGAGGCAGTGACAGGGGGGGCGGTGCCAAGAACTGCTGGCAAGACAACGTGAAAGACAACGAGTGTGACTCAGATGCAGAAAATGAGCAAAACCATGATCCGAATGTGGAAGAATTTCTGCAGCAACAAGACACCGCCGTCATTTATCCTGAGGCGCCCGAGGAAGACCAGCGGCAGGGCACACCAGAAGCCAGCAGTCATGATGAAAACGGAACACCAGATGCATTTTCCCAGTTGCTCACCTGCCCGTATTGTGATAGAGGCTACAAGCGCTTTACCTCTTTGAAAGAACACATTAAGTACCGCCATGAGAAGAACGAGGACAACTTCAGCTGCTCCCTGTGCAGTTACACCTTTGCATACAGAACCCAGCTTGAACGTCAT

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

12 - Non Combustible Liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Minfei Jin et al.
PloS one, 9(8), e103965-e103965 (2014-08-05)
MicroRNA (miR)-150 has been reported to be dramatically downregulated in human epithelial ovarian cancer (EOC) tissues and patients' serum compared to normal controls. This study aimed to investigate clinical significance and molecular mechanisms of miR-150 in EOC. In the current
Jaehyuk Choi et al.
Nature genetics, 47(9), 1011-1019 (2015-07-21)
Cutaneous T cell lymphoma (CTCL) is a non-Hodgkin lymphoma of skin-homing T lymphocytes. We performed exome and whole-genome DNA sequencing and RNA sequencing on purified CTCL and matched normal cells. The results implicate mutations in 17 genes in CTCL pathogenesis
Zhenduo Lu et al.
Molecular cancer, 14, 102-102 (2015-05-15)
Restin belongs to MAGE superfamily and is known as MAGE H1. Restin was firstly cloned from HL-60 cells treated with all-trans retinoic acid (ATRA). Previous studies showed a pro-apoptotic role of Restin in several cell lines. However, little information is
Ashley M Holder et al.
Oncotarget, 6(23), 19500-19513 (2015-05-07)
Rapamycin analogues have antitumor efficacy in several tumor types, however few patients demonstrate tumor regression. Thus, there is a pressing need for markers of intrinsic response/resistance and rational combination therapies. We hypothesized that epithelial-to-mesenchymal transition (EMT) confers rapamycin resistance. We

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service