Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EMU021811

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Fn1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGTGCTTCATGCCGCTAGATGTGCAAGCTGACAGAGACGATTCTCGAGAGTAATCTTTCCAGCCCCACCCTACAAGTGTCTCTCTACCAAGGTCAATCCACACCCCAGTGATGTTAGCAGACCCTCCATCTTTGAGTGGTCCTTTCACCCTTAAGCCTTTTGCTCTGGAGCCATGTTCTCAGCTTCAGCACAATTTACAGCTTCTCCAAGCATCGCCCCGTGGGATGTTTTGAGACTTCTCTCCTCAATGGTGACAGTTGGTCACCCTGTTCTGCTTCAGGGTTTCAGTACTGCTCAGTGTTGTTTAAGAGAATCAAAAGTTCTTATGGTTTGGTCTGGGATCAATAGGGAAACACAGGTAGCCAACTAGGAGGAAATGTACTGAATGCTAGTACCCAAGACCTTGAGCAGGAAAGTCACCCAGACACCTCTGCTTTCTTTTGCC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Wenjian Wang et al.
Kidney international, 81(10), 1002-1014 (2012-03-02)
Scavenger receptor A (SR-A) is a key transmembrane receptor in the endocytosis of lipids and contributes to the pathogenesis of atherosclerosis. To assess its role in hyperlipidemic chronic kidney disease, wild-type and SR-A-deficient (knockout) mice underwent uninephrectomy followed by either
H W Zhang et al.
Cellular and molecular biology (Noisy-le-Grand, France), 61(2), 26-32 (2015-05-31)
Endothelial progenitor cells (EPCs) could function as niche cells to promote self—renewal of mesenchymal stem cells (MSCs) in the mouse bone marrow. Cohesion was the basis of the two cells to display their biological functions to each other. In this
Tong-Peng Xu et al.
Journal of hematology & oncology, 7, 63-63 (2014-08-30)
FENDRR is a long non-coding RNAs (lncRNA) that binds to polycomb repressive complexe 2 (PRC2) to epigenetically regulate the expression of its target gene. The clinical role of FENDRR in carcinomas remains yet to be found. Real-time polymerase chain reaction

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service