Skip to Content
MilliporeSigma
All Photos(1)

Documents

EHU224041

Sigma-Aldrich

MISSION® esiRNA

targeting human NRAS

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTTTCTTTTAGCCATGTAGAAACTCTAAATTAAGCCAATATTCTCATTTGAGAATGAGGATGTCTCAGCTGAGAAACGTTTTAAATTCTCTTTATTCATAATGTTCTTTGAAGGGTTTAAAACAAGATGTTGATAAATCTAAGCTGATGAGTTTGCTCAAAACAGGAAGTTGAAATTGTTGAGACAGGAATGGAAAATATAATTAATTGATACCTATGAGGATTTGGAGGCTTGGCATTTTAATTTGCAGATAATACCCTGGTAATTCTCATGAAAAATAGACTTGGATAACTTTTGATAAAAGACTAATTCCAAAATGGCCACTTTGTTCCTGTCTTTAATATCTAAATACTTACTGAGGTCCTCCATCTTCTATATTATGAATTTTCATTTATTAAGCAAATGTCATATTACCTTGAAATTCAGAAGAGAAGAAACATATACTGTGTCCAGAGTATAATGAACCTGCAGAGTTGTGCTTCTTACTGCTAATTCTGGGAGCTTTCACAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Sha Liu et al.
Cancer medicine, 6(4), 819-833 (2017-03-24)
We aimed to detect the effects of miR-145-5p on the cell proliferation, apoptosis, migration, and invasion in NRAS-mutant, BRAF-mutant, and wild-type melanoma cells, in order to figure out the potential mechanisms and provide a novel therapeutic target of melanoma. RT-qPCR
Atsuko Ogino et al.
Molecular oncology, 15(1), 27-42 (2020-03-20)
Small-cell lung cancer (SCLC) occurs infrequently in never/former light smokers. We sought to study this rare clinical subset through next-generation sequencing (NGS) and by characterizing a representative patient-derived model. We performed targeted NGS, as well as comprehensive pathological evaluation, in
Xuemei Ji et al.
Journal of cellular biochemistry (2019-11-07)
Colorectal cancer (CRC) is a type of malignant cancer that has become particularly prevalent worldwide. It is of crucial importance to CRC treatment that the underlying molecular mechanism of CRC progression is determined. The NRAS gene is an important small
Arathi Nair et al.
Cell communication and signaling : CCS, 18(1), 3-3 (2020-01-08)
Ras are small cellular GTPases which regulate diverse cellular processes. It has three isoforms: H-Ras, K-Ras, and N-Ras. Owing to the N-terminus (1-165 residues) sequence homology these isoforms were thought to be functionally redundant. However, only K-Ras-deficient mice but not
Matthew E Welsch et al.
Cell, 168(5), 878-889 (2017-02-25)
Design of small molecules that disrupt protein-protein interactions, including the interaction of RAS proteins and their effectors, may provide chemical probes and therapeutic agents. We describe here the synthesis and testing of potential small-molecule pan-RAS ligands, which were designed to interact

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service