Skip to Content
MilliporeSigma
All Photos(1)

Documents

EHU146271

Sigma-Aldrich

MISSION® esiRNA

targeting human HNF1A

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TACCTGCAGCAGCACAACATCCCACAGCGGGAGGTGGTCGATACCACTGGCCTCAACCAGTCCCACCTGTCCCAACACCTCAACAAGGGCACTCCCATGAAGACGCAGAAGCGGGCCGCCCTGTACACCTGGTACGTCCGCAAGCAGCGAGAGGTGGCGCAGCAGTTCACCCATGCAGGGCAGGGAGGGCTGATTGAAGAGCCCACAGGTGATGAGCTACCAACCAAGAAGGGGCGGAGGAACCGTTTCAAGTGGGGCCCAGCATCCCAGCAGATCCTGTTCCAGGCCTATGAGAGGCAGAAGAACCCTAGCAAGGAGGAGCGAGAGACGCTAGTGGAGGAGTGCAATAGGGCGGAATGCATCCAGAGAGGGGTGTCCCCATCACAGGCACAGGGGCTGGGCTCCAACCTCGTCACGGAGGTGCGTGTCTACAACTGGTTTGCCAACC

Ensembl | human accession no.

ENSG00000135100

NCBI accession no.

NM_000545

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... HNF1A(6927) , HNF1A(6927)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Oğuzhan Fatih Baltacı et al.
Turkish journal of medical sciences, 48(3), 620-627 (2018-06-20)
Background/aim: MODY3 associated with HNF1A is the most common form of MODY and is clinically misdiagnosed as type 1 diabetes due to similar clinical symptoms. This study aimed to analyze the role of HNF1A-regulated miRNAs as a biomarker in the
Ethan V Abel et al.
eLife, 7 (2018-08-04)
The biological properties of pancreatic cancer stem cells (PCSCs) remain incompletely defined and the central regulators are unknown. By bioinformatic analysis of a human PCSC-enriched gene signature, we identified the transcription factor HNF1A as a putative central regulator of PCSC
Dusan Hrckulak et al.
Genes, 9(9) (2018-09-12)
T-cell factor 4 (TCF4), together with β-catenin coactivator, functions as the major transcriptional mediator of the canonical wingless/integrated (Wnt) signaling pathway in the intestinal epithelium. The pathway activity is essential for both intestinal homeostasis and tumorigenesis. To date, several mouse
Shipra Shukla et al.
Cancer cell, 32(6), 792-806 (2017-11-21)
Prostate cancer exhibits a lineage-specific dependence on androgen signaling. Castration resistance involves reactivation of androgen signaling or activation of alternative lineage programs to bypass androgen requirement. We describe an aberrant gastrointestinal-lineage transcriptome expressed in ∼5% of primary prostate cancer that
Weigong Zhao et al.
International journal of molecular sciences, 16(5), 11699-11712 (2015-05-27)
MicroRNAs (miRNAs) have been reported to have diverse biological roles in regulating many biological processes, including osteogenic differentiation. In the present study, we identified that miR-24 was a critical regulator during osteogenic differentiation. We found that overexpression of miR-24 significantly

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service