Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU137791

Sigma-Aldrich

MISSION® esiRNA

targeting human KIF14

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AATGGGAACCCGACATTACAGATGCACCAGTTTCTTCACTTTCTAGAAGGAGGAGTAGGAGTTTGATGAAGAACAGAAGAATTTCTGGTTGTTTACATGACATACAAGTCCATCCAATTAAGAATTTGCATTCTTCACATTCATCAGGTTTAATGGACAAATCAAGCACTATTTACTCAAATTCAGCAGAGTCCTTTCTTCCTGGAATTTGCAAAGAATTGATTGGTTCTTCGTTAGATTTTTTTGGACAGAGTTATGATGAAGAAAGAACTATAGCAGACAGCCTAATTAATAGTTTTCTTAAAATTTATAATGGGCTATTTGCCATTTCCAAGGCTCATGAAGAACAAGATGAAGAAAGTCAAGATAACTTGTTTTCTTCTGATCGAGCAATCCAGTCACTTACTATTCAGACTGCATGTGCTTTTGAGC

Ensembl | human accession no.

ENSG00000118193

NCBI accession no.

NM_014875

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... KIF14(9928) , KIF14(9928)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Petra Pejskova et al.
The Journal of cell biology, 219(6) (2020-04-30)
Primary cilia play critical roles in development and disease. Their assembly and disassembly are tightly coupled to cell cycle progression. Here, we present data identifying KIF14 as a regulator of cilia formation and Hedgehog (HH) signaling. We show that RNAi
Kay Ka-Wai Li et al.
Laboratory investigation; a journal of technical methods and pathology, 97(8), 946-961 (2017-05-16)
Medulloblastoma (MB) is the most common malignant brain tumor in childhood. At present, there is no well-established targeted drug for majority of patients. The kinesin family member 14 (KIF14) is a novel oncogene located on chromosome 1q and is dysregulated
Wei Huang et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 37(5), 1659-1670 (2015-11-05)
The mitotic kinesin superfamily protein KIF14 is essential for cytokinesis and chromosome segregation, and increased KIF14 expression is related to a variety of human cancers. However, the role of KIF14 in the development and malignant progression of astrocytomas and the

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service