Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU133691

Sigma-Aldrich

MISSION® esiRNA

targeting human CSE1L

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTGATCCTGATCCTGCCATCCGACGTCCAGCTGAGAAATTTCTTGAATCTGTTGAAGGAAATCAGAATTATCCACTGTTGCTTTTGACATTACTGGAGAAGTCCCAGGATAATGTTATCAAAGTATGTGCTTCAGTAACATTCAAAAACTATATTAAAAGGAACTGGAGAATTGTTGAAGATGAACCAAACAAAATTTGTGAAGCCGATCGAGTGGCCATTAAAGCCAACATAGTGCACTTGATGCTTAGCAGCCCAGAGCAAATTCAGAAGCAGTTAAGTGATGCAATTAGCATTATTGGCAGAGAAGATTTTCCACAGAAATGGCCTGACTTGCTGACAGAAATGGTGAATCGCTTTCAGAGTGGAGATTTCCATGTTATTAATGGAGTCCTCCGTACAGCACATTCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Woan-Ruoh Lee et al.
Molecular carcinogenesis, 55(11), 1542-1552 (2015-09-04)
The Ras/ERK (extracellular signal-regulated protein kinase) and cAMP/PKA (protein kinase A) pathways are essential for the transcriptional activities of CREB (cAMP response element binding protein) and MITF (microphthalmia-associated transcription factor) in melanogenesis and the progression of melanoma. However, the interaction
Xuebing Wang et al.
OncoTargets and therapy, 13, 1941-1951 (2020-04-11)
Recent studies have shown that noncoding RNAs (ncRNAs) play essential roles in the development of a number of cancers. Circular RNAs (circRNAs) have been shown to contribute to the progression of colorectal cancer (CRC). In this study, the expression levels
Jose M Pimiento et al.
The American journal of pathology, 186(10), 2761-2768 (2016-08-16)
Human cellular apoptosis susceptibility (chromosomal segregation 1-like, CSE1L) gene plays a role in nuclear-to-cytoplasm transport and chromosome segregation during mitosis, cellular proliferation, and apoptosis. CSE1L is involved in colon carcinogenesis. CSE1L gene expression was assessed with three data sets using

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service