Skip to Content
MilliporeSigma
All Photos(1)

Documents

EHU133631

Sigma-Aldrich

MISSION® esiRNA

targeting human ITCH

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACCTGCCACCATACAAGAGCTATGAGCAACTGAAGGAAAAGCTGTTGTTTGCCATAGAAGAAACAGAAGGATTTGGACAAGAGTAACTTCTGAGAACTTGCACCATGAATGGGCAAGAACTTATTTGCAATGTTTGTCCTTCTCTGCCTGTTGCACATCTTGTAAAATTGGACAATGGCTCTTTAGAGAGTTATCTGAGTGTAAGTAAATTAATGTTCTCATTTAGATTTATCTCCCAGTGATTTCTACTCAGCGTTTCCAGAAATCAGGTCTGCAAATGACTAGTCAGAACCTTGCTTAACATGAGATTTTAACACAACAATGAAATTTGCCTTGTCTTATTCCACTAGTTTATTCCTTTAACAACAATATTTTATGTGTGTCAAAAGTCTCACTTGGGAGTAGTGTTTTTTTCTTTTAGACATTCTGCAGACATGCAGGGAAGTCCTTTG

Ensembl | human accession no.

ENSG00000078747

NCBI accession no.

NM_031483

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ITCH(83737) , ITCH(83737)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yoichiro Otaki et al.
Journal of the American Heart Association, 5(1) (2016-01-23)
The homologous to the E6-AP carboxyl terminus (HECT)-type ubiquitin E3 ligase ITCH is an enzyme that plays a pivotal role in posttranslational modification by ubiquitin proteasomal protein degradation. Thioredoxin-interacting protein (TXNIP) is a negative regulator of the thioredoxin system and
Lufen Chang et al.
Nucleic acids research, 47(2), 824-842 (2018-12-06)
The downregulation of the DNA damage response (DDR) enables aggressive tumors to achieve uncontrolled proliferation against replication stress, but the mechanisms underlying this process in tumors are relatively complex. Here, we demonstrate a mechanism through which a distinct E3 ubiquitin
Ji-Yeon Park et al.
Biochemical and biophysical research communications, 470(2), 336-342 (2016-01-23)
This study aimed to investigate the roles of autophagy and the ubiquitin-proteasome system in the degradation of histone deacetylase 8 (HDAC8) and to clarify the mechanism by which cAMP signaling regulates this degradation. cAMP signaling was activated by treating H1299
Nicolas Baillet et al.
Viruses, 12(1) (2020-01-08)
Lassa virus (LASV) and Mopeia virus (MOPV) are two closely related, rodent-born mammarenaviruses. LASV is the causative agent of Lassa fever, a deadly hemorrhagic fever endemic in West Africa, whereas MOPV is non-pathogenic in humans. The Z matrix protein of
Jinhong Meng et al.
Scientific reports, 10(1), 1046-1046 (2020-01-25)
P53 mutations are responsible for drug-resistance of tumour cells which impacts on the efficacy of treatment. Alternative tumour suppressor pathways need to be explored to treat p53- deficient tumours. The E3 ubiquitin ligase, ITCH, negatively regulates the tumour suppressor protein

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service