Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU131141

Sigma-Aldrich

MISSION® esiRNA

targeting human CDH5

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAGCCTCTGATTGGCACAGTGCTGGCCATGGACCCTGATGCGGCTAGGCATAGCATTGGATACTCCATCCGCAGGACCAGTGACAAGGGCCAGTTCTTCCGAGTCACAAAAAAGGGGGACATTTACAATGAGAAAGAACTGGACAGAGAAGTCTACCCCTGGTATAACCTGACTGTGGAGGCCAAAGAACTGGATTCCACTGGAACCCCCACAGGAAAAGAATCCATTGTGCAAGTCCACATTGAAGTTTTGGATGAGAATGACAATGCCCCGGAGTTTGCCAAGCCCTACCAGCCCAAAGTGTGTGAGAACGCTGTCCATGGCCAGCTGGTCCTGCAGATCTCCGCAATAGACAAGGACATAACACCACGAAACGTGAAGTTCAAATTCATCTTGAATACTGAGAACAACTTTACCCTCACGGATAATCACGATAACACGGCCAACATCACAGTCAAGTATGGGCAGTTTGACCG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Zhiyong Wu et al.
American journal of translational research, 8(10), 4310-4319 (2016-11-11)
Angiotensin II (AngII) involved in the pathogenesis of pulmonary injury through impairing the integrity of pulmonary microvascular endothelial barrier, but the mechanism is still not clear. We aim to determine the roles of VE-cadherin, playing crucial roles in the adhesion
Miwa Sato et al.
PloS one, 10(9), e0137301-e0137301 (2015-09-04)
We developed a microfluidic model of microcirculation containing both blood and lymphatic vessels for examining vascular permeability. The designed microfluidic device harbors upper and lower channels that are partly aligned and are separated by a porous membrane, and on this
Natalia Colás-Algora et al.
Cellular and molecular life sciences : CMLS, 77(11), 2125-2140 (2019-08-10)
VE-cadherin plays a central role in controlling endothelial barrier function, which is transiently disrupted by proinflammatory cytokines such as tumor necrosis factor (TNFα). Here we show that human endothelial cells compensate VE-cadherin degradation in response to TNFα by inducing VE-cadherin

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service