Skip to Content
MilliporeSigma
All Photos(1)

Documents

EHU123481

Sigma-Aldrich

MISSION® esiRNA

targeting human RTN4

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCAGGAATGACAAAGCTTGCTTTTCTGGTATGTTCTAGGTGTATTGTGACTTTTACTGTTATATTAATTGCCAATATAAGTAAATATAGATTATATATGTATAGTGTTTCACAAAGCTTAGACCTTTACCTTCCAGCCACCCCACAGTGCTTGATATTTCAGAGTCAGTCATTGGTTATACATGTGTAGTTCCAAAGCACATAAGCTAGAAGAAGAAATATTTCTAGGAGCACTACCATCTGTTTTCAACATGAAATGCCACACACATAGAACTCCAACATCAATTTCATTGCACAGACTGACTGTAGTTAATTTTGTCACAGAATCTATGGACTGAATCTAATGCTTCCAAAAATGTTGTTTGTTTGCAAATATCAAACATTGTTATGCAAGAAATTATTAATTACAAAATGAAGATTTATACCATTGTGGTTTAAGCTGTACTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Related Categories

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yu-Jie Chen et al.
The Journal of cell biology, 219(2) (2020-01-03)
Escape of large macromolecular complexes from the endoplasmic reticulum (ER), such as a viral particle or cellular aggregate, likely induces mechanical stress initiated on the luminal side of the ER membrane, which may threaten its integrity. How the ER responds
Jin-Kyu Park et al.
Hepatology (Baltimore, Md.), 65(5), 1720-1734 (2017-01-17)
Nogo-B (Reticulon 4B) is an endoplasmic reticulum (ER) resident protein that regulates ER structure and function. Because ER stress is known to induce M2 macrophage polarization, we examined whether Nogo-B regulates M1/M2 polarization of Kupffer cells and alters the pathogenesis
Jiajia Cui et al.
Journal of controlled release : official journal of the Controlled Release Society, 304, 259-267 (2019-05-06)
Degradable poly(amine-co-ester) (PACE) terpolymers hold tremendous promise for siRNA delivery because these materials can be formulated into delivery vehicles with highly efficient siRNA encapsulation, providing effective knockdown with low toxicity. Here, we demonstrate that PACE nanoparticles (NPs) provide substantial protein
Dae-Gyun Ahn et al.
Cell cycle (Georgetown, Tex.), 14(14), 2301-2310 (2015-05-07)
Dysregulation of Ras signaling is the major cause of various cancers. Aberrant Ras signaling, however, provides a favorable environment for many viruses, making them suitable candidates as cancer-killing therapeutic agents. Susceptibility of cancer cells to such viruses is mainly due

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service