Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU114171

Sigma-Aldrich

MISSION® esiRNA

targeting human FTH1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCCAGAACTACCACCAGGACTCAGAGGCCGCCATCAACCGCCAGATCAACCTGGAGCTCTACGCCTCCTACGTTTACCTGTCCATGTCTTACTACTTTGACCGCGATGATGTGGCTTTGAAGAACTTTGCCAAATACTTTCTTCACCAATCTCATGAGGAGAGGGAACATGCTGAGAAACTGATGAAGCTGCAGAACCAACGAGGTGGCCGAATCTTCCTTCAGGATATCAAGAAACCAGACTGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCATTACATTTGGAAAAAAATGTGAATCAGTCACTACTGGAACTGCACAAACTGGCCACTGACAAAAATGACCCCCATTTGTGTGACTTCATTGAGACACATTACCTGAATGAGCAGGTGAAAGCCATC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Katalin Éva Sikura et al.
Arteriosclerosis, thrombosis, and vascular biology, 39(3), 413-431 (2019-02-01)
Objective- Calcific aortic valve disease is a prominent finding in elderly and in patients with chronic kidney disease. We investigated the potential role of iron metabolism in the pathogenesis of calcific aortic valve disease. Approach and Results- Cultured valvular interstitial
Vagisha Ravi et al.
PloS one, 14(9), e0221952-e0221952 (2019-09-07)
Elevated expression of the iron regulatory protein, ferritin heavy chain 1 (FTH1), is increasingly being associated with high tumor grade and poor survival outcomes in glioblastoma. Glioma initiating cells (GICs), a small population of stem-like cells implicated in therapeutic resistance
Caitlin W Brown et al.
Developmental cell, 51(5), 575-586 (2019-11-19)
Ferroptosis, regulated cell death characterized by the iron-dependent accumulation of lethal lipid reactive oxygen species, contributes to tissue homeostasis and numerous pathologies, and it may be exploited for therapy. Cells differ in their sensitivity to ferroptosis, however, and a key

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service