Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU110691

Sigma-Aldrich

MISSION® esiRNA

targeting human H2AFZ

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCCATCCTGGAGTACCTCACCGCAGAGGTACTTGAACTGGCAGGAAATGCATCAAAAGACTTAAAGGTAAAGCGTATTACCCCTCGTCACTTGCAACTTGCTATTCGTGGAGATGAAGAATTGGATTCTCTCATCAAGGCTACAATTGCTGGTGGTGGTGTCATTCCACACATCCACAAATCTCTGATTGGGAAGAAAGGACAACAGAAGACTGTCTAAAGGATGCCTGGATTCCTTGTTATCTCAGGACTCTAAATACTCTAACAGCTGTCCAGTGTTGGTGATTCCAGTGGACTGTATCTCTGTGAAAAACACAATTTTGCCTTTTTGTAATTCTATTTGAGCAAGTTGGAAGTTTAATTAGCTTTCCAACCAACCAAATTTCTGCATTCGAGTCTTAACCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Daniel S Day et al.
Genome biology, 17(1), 120-120 (2016-06-05)
For many genes, RNA polymerase II stably pauses before transitioning to productive elongation. Although polymerase II pausing has been shown to be a mechanism for regulating transcriptional activation, the extent to which it is involved in control of mammalian gene
Kristin E Murphy et al.
Nature communications, 11(1), 5063-5063 (2020-10-10)
Genome-wide chromatin state underlies gene expression potential and cellular function. Epigenetic features and nucleosome positioning contribute to the accessibility of DNA, but widespread regulators of chromatin state are largely unknown. Our study investigates how coordination of ANP32E and H2A.Z contributes

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service