Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU109151

Sigma-Aldrich

MISSION® esiRNA

targeting human DNAJB1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAGACCCTCATGCCATGTTTGCTGAGTTCTTCGGTGGCAGAAATCCCTTTGACACCTTTTTTGGGCAGCGGAACGGGGAGGAAGGCATGGACATTGATGACCCATTCTCTGGCTTCCCTATGGGCATGGGTGGCTTCACCAACGTGAACTTTGGCCGCTCCCGCTCTGCCCAAGAGCCCGCCCGAAAGAAGCAAGATCCCCCAGTCACCCACGACCTTCGAGTCTCCCTTGAAGAGATCTACAGCGGCTGTACCAAGAAGATGAAAATCTCCCACAAGCGGCTAAACCCCGACGGAAAGAGCATTCGAAACGAAGACAAAATATTGACCATCGAAGTGAAGAAGGGGTGGAAAGAAGGAACCAAAATCACTTTCCCCAAGGAAGGAGACCAGACCTCCAACAACATTCCAGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Sei-Kyoung Park et al.
PLoS genetics, 13(5), e1006805-e1006805 (2017-05-23)
Amyotrophic lateral sclerosis (ALS) is a devastating neurodegenerative disease characterized by selective loss of motor neurons with inclusions frequently containing the RNA/DNA binding protein TDP-43. Using a yeast model of ALS exhibiting TDP-43 dependent toxicity, we now show that TDP-43
Jyoti Batra et al.
Scientific reports, 6, 19063-19063 (2016-01-12)
A unique feature of influenza A virus (IAV) life cycle is replication of the viral genome in the host cell nucleus. The nuclear import of IAV genome is an indispensable step in establishing virus infection. IAV nucleoprotein (NP) is known

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service