Skip to Content
MilliporeSigma
All Photos(1)

Documents

EHU108601

Sigma-Aldrich

MISSION® esiRNA

targeting human RBM4, RBM14-RBM4

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGAGATTCGCTCACTCTTCGAGCAGTATGGGAAGGTGCTGGAATGTGACATCATTAAGAATTACGGCTTTGTGCACATAGAAGACAAGACGGCAGCTGAGGATGCCATACGCAACCTGCACCATTACAAGCTTCATGGGGTGAACATCAACGTGGAAGCCAGCAAGAATAAGAGCAAAACCTCAACAAAGTTGCATGTGGGCAACATCAGTCCCACCTGCACCAATAAGGAGCTTCGAGCCAAGTTTGAGGAGTATGGTCCGGTCATCGAATGTGACATCGTGAAAGATTATGCCTTCGTACACATGGAGCGGGCAGAGGATGCAGTGGAGGCCATCAGGGGCCTTGATAACACAGAGTTTCAAGGCAAACGAATGCACGTGCAGTTGTCCACCAGCCGGCTTAGGACTGCGCCCGGGATGGGAGACCAGAGCGGCTGCTATCGGTGCGGGAAAGAGGGGCACTGGTCCAAAGAGTGTCCG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Guo-Wei Huang et al.
The international journal of biochemistry & cell biology, 90, 59-67 (2017-07-30)
LncRNAs play a vital role in alternative splicing of target genes. However, the mechanisms underlying lncRNAs involvement in splicing are poorly understood. In the present study, we identified a previously uncharacterized lncRNA, which is denoted as TPM1-AS, is reverse-transcribed from
S Kagawa et al.
Oncogene, 34(18), 2347-2359 (2014-06-17)
Notch activity regulates tumor biology in a context-dependent and complex manner. Notch may act as an oncogene or a tumor-suppressor gene even within the same tumor type. Recently, Notch signaling has been implicated in cellular senescence. Yet, it remains unclear
Sven Hennig et al.
The Journal of cell biology, 210(4), 529-539 (2015-08-19)
Prion-like domains (PLDs) are low complexity sequences found in RNA binding proteins associated with the neurodegenerative disorder amyotrophic lateral sclerosis. Recently, PLDs have been implicated in mediating gene regulation via liquid-phase transitions that drive ribonucleoprotein granule assembly. In this paper

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service