Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU090761

Sigma-Aldrich

MISSION® esiRNA

targeting human CASP7

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGTGTTTCAACAGAGGGAGTTTAATACAGGAAATTGACTTACATAGATGATAAAAGAGAAGCCAAACAGCAAGAAGCTGTTACCACACCCAGGGCTATGAGGATAATGGGAAGAGGTTTGGTTTCCTGTGTCCAGTAGTGGGATCATCCAGAGGAGCTGGAACCATGGTGGGGGCTGCCTAGTGGGAGTTAGGACCACCAATGGATTGTGGAAAATGGAGCCATGACAAGAACAAAGCCACTGACTGAGATGGAGTGAGCTGAGACAGATAAGAGAATACCTTGGTCTCACCTATCCTGCCCTCACATCTTCCACCAGCACCTTACTGCCCAGGCCTATCTGGAAGCCACCTCACCAAGGACCTTGGAAGAGCAAGGGACAGTGAGGCAGGAGAAGAACAAGAAATGGATGTAAGCCTGGCCCATAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Related Categories

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ri Cui et al.
Oncotarget, 6(26), 21802-21815 (2015-08-27)
We recently reported that miR-224 was significantly up-regulated in non-small cell lung cancer (NSCLC) tissues, in particular in resected NSCLC metastasis. We further demonstrated that miR-224 functions as an oncogene in NSCLC by directly targeting TNFAIP1 and SMAD4. However, the
Woo Jin Jeong et al.
PloS one, 7(9), e45754-e45754 (2012-10-11)
In addition to its well-characterized role in the lens, αB-crystallin performs other functions. Methylglyoxal (MGO) can alter the function of the basement membrane of retinal pigment epithelial (RPE) cells. Thus, if MGO is not efficiently detoxified, it can induce adverse
Xiujin Shen et al.
Cell death & disease, 12(2), 186-186 (2021-02-17)
Chemotherapy drug-induced nephrotoxicity limits clinical applications for treating cancers. Pyroptosis, a newly discovered programmed cell death, was recently reported to be associated with kidney diseases. However, the role of pyroptosis in chemotherapeutic drug-induced nephrotoxicity has not been fully clarified. Herein

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service