Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU083751

Sigma-Aldrich

MISSION® esiRNA

targeting human VCAM1

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
$303.00
50 μG
$571.00

$303.00


Please contact Customer Service for Availability


Select a Size

Change View
20 μG
$303.00
50 μG
$571.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

$303.00


Please contact Customer Service for Availability

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGTTGAAGGATGCGGGAGTATATGAATGTGAATCTAAAAACAAAGTTGGCTCACAATTAAGAAGTTTAACACTTGATGTTCAAGGAAGAGAAAACAACAAAGACTATTTTTCTCCTGAGCTTCTCGTGCTCTATTTTGCATCCTCCTTAATAATACCTGCCATTGGAATGATAATTTACTTTGCAAGAAAAGCCAACATGAAGGGGTCATATAGTCTTGTAGAAGCACAGAAGTCAAAAGTGTAGCTAATGCTTGATATGTTCAACTGGAGACACTATTTATCTGTGCAAATCCTTGATACTGCTCATCATTCCTTGAGAAAAACAATGAGCTGAGAGGCAGACTTCCCTGAATGTATTGAACTTGGAAAGAAATGCCCATCTATGTCCCTTGCTGTGAGCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Hai-Jian Sun et al.
Scientific reports, 6, 23596-23596 (2016-03-24)
Vascular smooth muscle cells (VSMCs) are indispensible components in foam cell formation. Salusin-β is a stimulator in the progression of atherosclerosis. Here, we showed that salusin-β increased foam cell formation evidenced by accumulation of lipid droplets and intracellular cholesterol content
Orawin Prangsaengtong et al.
Vascular medicine (London, England), 23(3), 201-211 (2018-04-10)
Lymphangiogenesis is the process of new vessel formation from pre-existing lymphatic vessels. The process mainly involves cell adhesion, migration, and tubule formation of lymphatic endothelial cells. Tumor-induced lymphangiogenesis is an important factor contributing to promotion of tumor growth and cancer
Ryota Takahashi et al.
Scientific reports, 10(1), 21194-21194 (2020-12-05)
Pancreatic cancer is one of the malignant diseases with the worst prognosis. Resistance to chemotherapy is a major difficulty in treating the disease. We analyzed plasma samples from a genetically engineered mouse model of pancreatic cancer and found soluble vascular
Huilin Ye et al.
Cell death & disease, 9(5), 453-453 (2018-04-20)
Tumor-associated macrophages (TAMs) are frequently found near pancreatic cancer cells, but it is uncertain whether they are involved in pancreatic cancer progression and the Warburg effect. Here, we show that CCL18 secreted by TAMs facilitates malignant progression and induced a
Taek-Keun Kim et al.
Experimental & molecular medicine, 49(2), e294-e294 (2017-02-18)
Tumor necrosis factor alpha (TNFα)-induced angiogenesis plays important roles in the progression of various diseases, including cancer, wet age-related macular degeneration, and rheumatoid arthritis. However, the relevance and role of vascular cell adhesion molecule-1 (VCAM-1) in angiogenesis have not yet

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service