Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU082131

Sigma-Aldrich

MISSION® esiRNA

targeting human FMR1

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
$303.00
50 μG
$571.00

$303.00


Please contact Customer Service for Availability


Select a Size

Change View
20 μG
$303.00
50 μG
$571.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

$303.00


Please contact Customer Service for Availability

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CACCTCAAAGCGAGCACATATGCTGATTGACATGCACTTTCGGAGTCTGCGCACTAAGTTGTCTCTGATAATGAGAAATGAAGAAGCTAGTAAGCAGCTGGAGAGTTCAAGGCAGCTTGCCTCGAGATTTCATGAACAGTTTATCGTAAGAGAAGATCTGATGGGTCTAGCTATTGGTACTCATGGTGCTAATATTCAGCAAGCTAGAAAAGTACCTGGGGTCACTGCTATTGATCTAGATGAAGATACCTGCACATTTCATATTTATGGAGAGGATCAGGATGCAGTGAAAAAAGCTAGAAGCTTTCTCGAATTTGCTGAAGATGTAATACAAGTTCCAAGGAACTTAGTAGGCAAAGTAATAGGAAAAAATGGAAAGCTGATTCAGGAGATTGTGGACAAGTCAGGAGTTGTGAGGGTGAGGATTGAGGCTGAAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Muzammil Ahmad et al.
Nucleic acids research, 44(13), 6335-6349 (2016-06-04)
DNA Topoisomerases are essential to resolve topological problems during DNA metabolism in all species. However, the prevalence and function of RNA topoisomerases remain uncertain. Here, we show that RNA topoisomerase activity is prevalent in Type IA topoisomerases from bacteria, archaea
Veronica Nobile et al.
Human genetics, 139(2), 227-245 (2020-01-11)
Fragile X-related disorders are due to a dynamic mutation of the CGG repeat at the 5' UTR of the FMR1 gene, coding for the RNA-binding protein FMRP. As the CGG sequence expands from premutation (PM, 56-200 CGGs) to full mutation
Laurent Ferron et al.
Neurobiology of disease, 138, 104779-104779 (2020-01-29)
Fragile X syndrome (FXS), the most common form of inherited intellectual disability and autism, results from the loss of fragile X mental retardation protein (FMRP). We have recently identified a direct interaction of FMRP with voltage-gated Ca2+ channels that modulates

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service