Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU081321

Sigma-Aldrich

MISSION® esiRNA

targeting human BDNF

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
$303.00
50 μG
$571.00

$303.00


Please contact Customer Service for Availability


Select a Size

Change View
20 μG
$303.00
50 μG
$571.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

$303.00


Please contact Customer Service for Availability

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTATCAGAAAGCCCCAAGCAATTGCTGCATCTTAGTAGGGTGAGGGATAAGCAAAAGAGGATGTTCACCATAACCCAGGAATGAAGATACCATCAGCAAAGAATTTCAATTTGTTCAGTCTTTCATTTAGAGCTAGTCTTTCACAGTACCATCTGAATACCTCTTTGAAAGAAGGAAGACTTTACGTAGTGTAGATTTGTTTTGTGTTGTTTGAAAATATTATCTTTGTAATTATTTTTAATATGTAAGGAATGCTTGGAATATCTGCTGTATGTCAACTTTATGCAGCTTCCTTTTGAGGGACAAATTTAAAACAAACAACCCCCCATCACAAACTTAAAGGATTGCAAGGGCCAGATCTGTTAAGTGGTTTCATAGGAGACACATCCAGCAATTGTGTGGTC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

L Gao et al.
Neoplasma, 65(1), 89-96 (2018-01-13)
Recent studies have confirmed the existence of BDNF and tropomyosin-related kinase B (TrkB) in normal and cancerous urothelium. However, the corresponding mechanisms and upstream signal pathways of BDNF/TrkB have not been fully discovered. This study aimed to investigate the effects
Yu-Pu Liu et al.
Frontiers in neuroscience, 14, 525144-525144 (2020-11-03)
Growing evidence indicates that electroacupuncture (EA) has a definite effect on the treatment of peripheral nerve injury (PNI), but its mechanism is not completely clear. MicroRNAs (miRNAs) are involved in the regulation of a variety of biological processes, and EA
Abdelrahman Y Fouda et al.
Molecular neurobiology, 54(1), 661-670 (2016-01-14)
Angiotensin type 1 receptor blockers (ARBs) have been shown to be neuroprotective and neurorestorative in experimental stroke. The mechanisms proposed include anti-inflammatory, antiapoptotic effects, as well as stimulation of endogenous trophic factors leading to angiogenesis and neuroplasticity. We aimed to
Chun-Yan Sun et al.
Oncology reports, 37(5), 2751-2760 (2017-04-14)
Brain-derived neurotrophic factor (BDNF) is expressed in a number of neural and non-neuronal tumors. The present study investigated the effect of endogenous BDNF on the biological behavior of cervix cancer cells using small interfering RNA (siRNA). HeLa, a cervix cancer
So Yoon Ahn et al.
Cell transplantation, 26(1), 145-156 (2016-08-19)
Mesenchymal stem cell (MSC) transplantation protects against neonatal severe intraventricular hemorrhage (IVH)-induced brain injury by a paracrine rather than regenerative mechanism; however, the paracrine factors involved and their roles have not yet been delineated. This study aimed to identify the

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service